Previous Contig 001045:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020N18Sequence565001045 (8)758010447 (6)gb:AP005012_18472746e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P062
JMFF031C03Sequence495001045 (8)615010447 (6)gb:AP005012_18472746e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P062
JMFF044J23Sequence631001045 (8)gb:AE005173_8953475e-06Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC013430_153616010447 (6)gb:AP005012_18472744e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P062
JMFS097D01Sequence627001045 (8)gb:AE005173_8953474e-08Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC013430_153
JMFS135G12Sequence595001045 (8)gb:AE005173_8953476e-24Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC013430_153
JMFS158G01Sequence579001045 (8)
JMSF009B14Sequence243001045 (8)755010447 (6)gb:AP005012_18472742e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P062
JMSF040N15Sequence650001045 (8)809010447 (6)gb:AP005012_18472746e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P062

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS135G12+ AAAGCCTAACTC
                      ____________________________________________________________
consensus AAAGCCTAACTC
 
. : . : . : . : . : . :
JMFS135G12+ GAGACTTTCTGACACATTAAAGCATGGAACATAATTCTCAGCCTCGGGTGGACAATACTC
                      ____________________________________________________________
consensus GAGACTTTCTGACACATTAAAGCATGGAACATAATTCTCAGCCTCGGGTGGACAATACTC
 
. : . : . : . : . : . :
JMFS135G12+ CAGATCCTTCAATTTAGAAGAACCAAGAGACAAGTGTCCAATGTCCTTCAAGTCCAACAC
JMFS097D01+ TCAAGTCCAACAC
JMFF044J23+ C
                      ____________________________________________________________
consensus CAGATCCTTCAATTTAGAAGAACCAAGAGACAAGTGTCCAATGTCCTTCAAGTCCAACAC
 
. : . : . : . : . : . :
JMFS135G12+ TACTTGTTCTTGAAGCCTACGGTACCCATGATATATTTTACCCCTGGATGAGCTCGTTAT
JMFS097D01+ TACTTGTTCTTGAAGCCTACGGTACCCATGATATATTTTACCCCTGGATGAGCTCGTTAT
JMFF044J23+ TACTTGTTCTGNAAGCCTACGGTACCCATGATATATTTTACCCCTGGATGAGCTCGTTAT
                      ____________________________________________________________
consensus TACTTGTTCTTGAAGCCTACGGTACCCATGATATATTTTACCCCTGGATGAGCTCGTTAT
 
. : . : . : . : . : . :
JMFS135G12+ TGAGATTGTCCACCAAAAGGATCCAGTAAGAGCAAGAACTACTATGGCAACTAAGCTAAG
JMFS097D01+ TGAGATTGTCCACCAAAAGGATCCAGTAAGAGCAAGAACTACTATGGCAACTAAGCTAAG
JMFF044J23+ TGAGATTGTCCACCAAAAGGATCCAGTAAGAGCAAGAACTACTATGGCAACTAAGCTAAG
JMFS158G01+ AAG
JMSF040N15+ CCAAAAGGATCCAGTAAGAGCAAGAACTACTATGGCAACTAAGCTAAG
                      ____________________________________________________________
consensus TGAGATTGTCCACCAAAAGGATCCAGTAAGAGCAAGAACTACTATGGCAACTAAGCTAAG
 
. : . : . : . : . : . :
JMFS135G12+ TTTGAGCAAAAGCAATGTGAACTTAATCTGACTTCGCCCAGCTCCAGGGCTGAAGGGATT
JMFS097D01+ TTTGAGCAAAAGCAATGTGAACTTAATCTGACTTCGCCCAGCTCCAGGGCTGAAGGGATT
JMFF044J23+ TTTGAGCAAAAGCAATGTGAACTTAATCTGACTTCGCCCAGCTCCAGGGCTGAAGGGATT
JMFS158G01+ TTTGAGCAAAAGCAATGTGAACTTAATCTGACTTCGCCCAGCTCCAGGGCTGAAGGGATT
JMSF040N15+ TTTGAGCAAAAGCAATGTGAACTTAATCTGACTTCGCCCAGCTCCAGGGCTGAAGGGATT
                      ____________________________________________________________
consensus TTTGAGCAAAAGCAATGTGAACTTAATCTGACTTCGCCCAGCTCCAGGGCTGAAGGGATT
 
. : . : . : . : . : . :
JMFS135G12+ AGATAGATAACCATTTTCACTAACACCATTCTTTGTAGGCGATTTGTCAGTGGAAAGAAT
JMFS097D01+ AGATAGATAACCATTTTCACTAACACCATTCTTTGTAGGCGATTTGTCAGTGGAAAGAAT
JMFF044J23+ AGATAGATAACCATTTTCACTAACACCATTCTTTGTAGGCGATTTGTCAGTGGAAAGAAT
JMFS158G01+ AGATAGATAACCATTTTCACTAACACCATTCTTTGTAGGCGATTTGTCAGTGGAAAGAAT
JMSF040N15+ AGATAGATAACCATTTTCACTAACACCATTCTTTGTAGGCGATTTGTCAGTGGAAAGAAT
JMFF020N18+ TAGGCGATTTGTCAGTGGAAAGAAT
                      ____________________________________________________________
consensus AGATAGATAACCATTTTCACTAACACCATTCTTTGTAGGCGATTTGTCAGTGGAAAGAAT
 
. : . : . : . : . : . :
JMFS135G12+ CCGTAAAAGAAATTTCATAGAGAGGAAACTCTGATCACCAGCTGATTGACTATGATCAAA
JMFS097D01+ CCGTAAAAGAAATTTCATAGAGAGGAAACTCTGATCACCAGCTGATTGACTATGATCAAA
JMFF044J23+ CCGTAAAAGAAATTTCATAGAGAGGAAACTCTGATCACCAGCTGATTGACTATGATCAAA
JMFS158G01+ CCGTAAAAGAAATTTCATAGAGAGGAAACTCTGATCACCAGCTGATTGACTATGATCAAA
JMSF040N15+ CCGTAAAAGAAATTTCATAGAGAGGAAACTCTGATCACCAGCTGATTGACTATGATCAAA
JMFF031C03+ TTGACTATGATCAAA
JMFF020N18+ CCGTAAAAGAAATTTCATAGAGAGGAAACTCTGATCACCAGCTGATTGACTATGATCAAA
                      ____________________________________________________________
consensus CCGTAAAAGAAATTTCATAGAGAGGAAACTCTGATCACCAGCTGATTGACTATGATCAAA
 
. : . : . : . : . : . :
JMFS135G12+ ATCTTCTTTCTCTATTTTATCTTTCATCTGAGAGTCATCCAAGAAGCTCTGACTGTTCCC
JMFS097D01+ ATCTTCTTTCTCTATCTTATCTTTCATCTGAGAGTCATCCAAGAAGCTCTGACTGTTCCC
JMFF044J23+ ATCTTCTTTCTCTATCTTATCTTTCATCTGAGAGTCATCCAAGAAGCTCTGACTGTTCCC
JMFS158G01+ ATCTTCTTTCTCTATCTTATCTTTCATCTGAGAGTCATCCAAGAAGCTCTGACTGTTCCC
JMSF040N15+ ATCTTCTTTCTCTATCTTATCTTTCATCTGAGAGTCATCCAAGAAGCTCTGACTGTTCCC
JMFF031C03+ ATCTTCTTTCTNTATNNTATCTTTCATCTGAGAGTCATCCAAGAAGCTCTGACTGTTCCC
JMFF020N18+ ATCTTCTTTCTCTATCTTATCTTTCATCTGAGAGTCATCCAAGAAGCTCTGACTGTTCCC
                      ____________________________________________________________
consensus ATCTTCTTTCTCTATCTTATCTTTCATCTGAGAGTCATCCAAGAAGCTCTGACTGTTCCC
 
. : . : . : . : . : . :
JMFS135G12+ TGAGTGCCGGCCCCCACCTCCAACAGATAAACCTCTA
JMFS097D01+ TGAGTGCCGGCCCCCACCTCCAACAGATAAACCTCTATGCAGTGGCCTAGCCATAATCCG
JMFF044J23+ TGAGTGCCGGCCCCCACCTCCAACAGATAAACCTCTATGCAGTGGCCTAGCCATAATCCG
JMFS158G01+ TGAGTGCCGGCCCCCACCTCCAACAGATAAACCTCTATGCAGTGGCCTAGCCATAATCCG
JMSF040N15+ TGAGTGCCGGCCCCCACCTCCAACAGATAAACCTCTATGCAGTGGCCTAGCCATAATCCG
JMFF031C03+ TGAGTGCCGGCCCCCACCTCCAACAGATAAACCTCTATGCAGTGGCCTAGCCATAATCCG
JMFF020N18+ TGAGTGCCGGCCCCCACCTCCAACAGATAAACCTCTATGCAGTGGCCTAGCCATAATCCG
                      ____________________________________________________________
consensus TGAGTGCCGGCCCCCACCTCCAACAGATAAACCTCTATGCAGTGGCCTAGCCATAATCCG
 
. : . : . : . : . : . :
JMFS097D01+ CACTCCAGAAATGTATAAACTCAAAGAATCACTCACTCACTCACTCGCCGTTCGGCTCAG
JMFF044J23+ CACTCCAGAAATGTATAAACTCAAAGAATCACTCACTCACTCACTCGCCGTTCGGCTCAG
JMFS158G01+ CACTCCAGAAATGTATAAACTCAAAGAATCACTCACTCACTCACTCGCCGTTCGGCTCAG
JMSF040N15+ CACTCCAGAAATGTATAAACTCAAAGAATCACTCACTCACTCACTCGCCGTTCGGCTCAG
JMFF031C03+ CACTCCAGAAATGTATAAACTCAAAGAATCACTCACTCACTCACTCGCCGTTNGGCTCAG
JMSF009B14+ GGCTCAG
JMFF020N18+ CACTCCAGAAATGTATAAACTCAAAGAATCACTCACTCACTCACTCGCCGTTCGGCTCAG
                      ____________________________________________________________
consensus CACTCCAGAAATGTATAAACTCAAAGAATCACTCACTCACTCACTCGCCGTTCGGCTCAG
 
. : . : . : . : . : . :
JMFS097D01+ TAAGTAAATAGTAGGCGAGTAAGTAAAAGAGTTGGTAAGCAAAGCTCGCTGATTGTTGAA
JMFF044J23+ TAAGTAAATAGTAGGCGAGTAAGTAAAAGAGTTGGTAAGCAAAGCTCGCTGATTGTTGAA
JMFS158G01+ TAAGTAAATAGTAGGCGAGTAAGTAAAAGAGTTGGTAAGCAAAGCTCGCTGATTGTTGAA
JMSF040N15+ TAAGTAAATAGTAGGCGAGTAAGTAAAAGAGTTGGTAAGCAAAGCTCGCTGATTGTTGAA
JMFF031C03+ TAAGTAAATAGTAGGCGAGTAAGTAAAAGAGTTGGTAAGCAAAGCTCGCTGATTGTTGAA
JMSF009B14+ TAAGTAAATAGTAGGCGAGTAAGTAAAAGAGTTGGTAAGCAAAGCTCGCTGATTGTTGAA
JMFF020N18+ TAAGTAAATAGTAGGCGAGTAAGTAAAAGAGTTGGTAAGCAAAGCTCGCTGATTGTTGAA
                      ____________________________________________________________
consensus TAAGTAAATAGTAGGCGAGTAAGTAAAAGAGTTGGTAAGCAAAGCTCGCTGATTGTTGAA
 
. : . : . : . : . : . :
JMFS097D01+ TAACTCTCCTCTTCCCAGCTGCCACCCGTGAAACGCAAACAAACCATCAATTTTCTCTCT
JMFF044J23+ TAACTCTCCTCTTCCCAGCTGCCACCCGTGAAACGCAAACAAACCATCAATTTTCTCTCT
JMFS158G01+ TAACTCTCCTCTTCCCAGCTGCCACCCGTGAAACGCAAACAAACCATCAATTTTCTCTCT
JMSF040N15+ TAACTCTCCTCTTCCCAGCTGCCACCCGTGAAACGCAAACAAACCATCAATTTTCTCTCT
JMFF031C03+ TAACTCTCCTCTTCCCAGCTGCCACCCGTGAAACGCAAACAAACCATCAATTTTCTCTCT
JMSF009B14+ TAACTCTCCTCTTCCCAGCTGCCACCCGTGAAACGCAAACAAACCATCAATTTTCTCTCT
JMFF020N18+ TAACTCTCCTCTTCCCAGCTGCCACCCGTGAAACGCAAACAAACCATCAATTTTCTCTCT
                      ____________________________________________________________
consensus TAACTCTCCTCTTCCCAGCTGCCACCCGTGAAACGCAAACAAACCATCAATTTTCTCTCT
 
. : . : . : . : . : . :
JMFS097D01+ CTCCCTCGTTTTTC
JMFF044J23+ CTCCCTCGTTTTTCCTCACTGCCTCTGCTT
JMFS158G01+ CTCCCTCGTTTTTCCTCACTGCCTCTGCTTATCAAATTCAGCTCGGTCGACGCGGTTTTG
JMSF040N15+ CTCCCTCGTTTTTCCTCACTGCCTCTGCTTATCAAATTCAGCTCGGTCGACGCGGTTTTG
JMFF031C03+ CTCCCTCGTTTTTCCTCACTGCCTCTGCTTATCAAATTCAGCTCGGTCGACGCGGTTTTG
JMSF009B14+ CTCCCTCGTTTTTCCTCACTGCCTCTGCTTATCAAATTCAGCTCGGTCGACGCGGTTTTG
JMFF020N18+ CTCCCTCGTTTTTCCTCACTGCCTCTGCTTATCAAATTCAGCTCGGTCGACGCGGTTTTG
                      ____________________________________________________________
consensus CTCCCTCGTTTTTCCTCACTGCCTCTGCTTATCAAATTCAGCTCGGTCGACGCGGTTTTG
 
. : . : . : . : . : . :
JMFS158G01+ GAGTTTTTAGAGAGAGAGAGAAATGGAGAGTCCTAA
JMSF040N15+ GAGTTTTTAGAGAGAGAGAGAAATGGAGAGTCCTAATCACTTGAAAGCTCGCTCG
JMFF031C03+ GAGTTTTTAGAGAGAGAGAGAAATGGAGAGTCCTAATCACTTGAAAGCTCGCTCGTGAAA
JMSF009B14+ GAGTTTTTAGAGAGAGAGAGAAATGGAGAGTCCTAATCACTTGAAAGCTCGCTCG
JMFF020N18+ GAGTTTTTAGAGAGAGAGAGAAATGGAGAGTCCTAATCACTTGAAAGCTCGCTCGTGAAA
                      ____________________________________________________________
consensus GAGTTTTTAGAGAGAGAGAGAAATGGAGAGTCCTAATCACTTGAAAGCTCGCTCGTGAAA
 
. : . : . : . : . : . :
JMFF031C03+ GACTTGAATCTGCCCCCTCGTCGGATTCATATACGTGACACCTTCTACGTACTAAAATCC
JMFF020N18+ GACTTGAATCTGCCCCCTCGTCGGATTCATATACGTGACACCTTCTACGTACTAAAATCC
                      ____________________________________________________________
consensus GACTTGAATCTGCCCCCTCGTCGGATTCATATACGTGACACCTTCTACGTACTAAAATCC