Previous Contig 001043:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020N11Sequence417001043 (4)gb:AK176784_18187723e-09Arabidopsis thaliana mRNA for putative thioredoxin M, complete cds, clone: RAFL2715001043 (4)gb:AK176784_18187721e-28Arabidopsis thaliana mRNA for putative thioredoxin M, complete cds, clone: RAFL2
JMFN030M16Sequence628001043 (4)sp|Q9SEU7|THM3_ARATH2e-39Thioredoxin M-type 3, chloroplast precursor (TRX-M3).>pir|F84530|F84530 probable
JMFN033E07Sequence625001043 (4)sp|Q9SEU7|THM3_ARATH2e-39Thioredoxin M-type 3, chloroplast precursor (TRX-M3).>pir|F84530|F84530 probable

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020N11- TTGAATACACAGGAGAAACAAAAATCAAAATCTACAGAATATTTATCCACTCAAAT
JMFN033E07+ TCAAAT
                      ____________________________________________________________
consensus TTGAATACACAGGAGAAACAAAAATCAAAATCTACAGAATATTTATCCACTCAAAT
 
. : . : . : . : . : . :
rJMFF020N11- TTCTGTACAAATAGTCTCTCATTATAACTTGGTTGCCCTGAGACACGGATAAGATGCAGT
JMFN033E07+ TTCTGTACAAATAGTCTCTCATTATAACTTGGTTGCCCTGAGACACGGATAAGATGCAGT
                      ____________________________________________________________
consensus TTCTGTACAAATAGTCTCTCATTATAACTTGGTTGCCCTGAGACACGGATAAGATGCAGT
 
. : . : . : . : . : . :
rJMFF020N11- TTGACAGCCCAGAACACATTGCAGTGGGAAGAAAGGAAGGAAAGAGCATAATTTATGATG
JMFN033E07+ TTGACAGCCCAGAACACATTGCAGTGGGAAGAAAGGAAGGAAAGAGCATAATTTATGATG
JMFN030M16+ ATGATG
                      ____________________________________________________________
consensus TTGACAGCCCAGAACACATTGCAGTGGGAAGAAAGGAAGGAAAGAGCATAATTTATGATG
 
. : . : . : . : . : . :
rJMFF020N11- AGCCAGCCATTCATAATGTTTCCATCTAAGAGGCTAAAACCCTCTCGATGGCATTGACGT
JMFN033E07+ AGCCAGCCATTCATAATGTTTCCATCTAAGAGGCTAAAACCCTCTCGATGGCATTGACGT
JMFN030M16+ AGCCAGCCATTCATAATGTTTCCATCTAAGAGGCTAAAACCCTCTCGATGGCATTGACGT
                      ____________________________________________________________
consensus AGCCAGCCATTCATAATGTTTCCATCTAAGAGGCTAAAACCCTCTCGATGGCATTGACGT
 
. : . : . : . : . : . :
rJMFF020N11- AGAACTCCTTGGGCATGGTACCCTATGACAGAACCGCGTTTCTCCCCATTCTTGAACAGC
JMFN033E07+ AGAACTCCTTGGGCATGGTACCCTATGACAGAACCGCGTTTCTCCCCATTCTTGAACAGC
JMFN030M16+ AGAACTCCTTGGGCATGGTACCCTATGACAGAACCGCGTTTCTCCCCATTCTTGAACAGC
                      ____________________________________________________________
consensus AGAACTCCTTGGGCATGGTACCCTATGACAGAACCGCGTTTCTCCCCATTCTTGAACAGC
 
. : . : . : . : . : . :
rJMFF020N11- ATCACCACTGGCACAGCCTTGATATCATAGTCCTCAGCAATTT-CACGTCTGAATCCGCA
JMFN033E07+ ATCACCACTGGCACAGCCTTGATATCATAGTCCTCAGCAATTTGCACGTCTGAATCCGCA
JMFN030M16+ ATCACCACTGGCACAGCCTTGATATCATAGTCCTCAGCAATTTGCACGTCTGAATCCGCA
                      ____________________________________________________________
consensus ATCACCACTGGCACAGCCTTGATATCATAGTCCTCAGCAATTTGCACGTCTGAATCCGCA
 
. : . : . : . : . : . :
rJMFF020N11- TTGAGTACAAAGCATTTTAATCTTCCTGAATAATCAGTTGCAATTTCATCCATCACCCTA
JMFN033E07+ TTGAGTACAAAGCATTTTAATCTTCCTGAATAATCAGTTGCAATTTCATCCATCACCCTA
JMFN030M16+ TTGAGTACAAAGCATTTTAATCTTCCTGAATAATCAGTTGCAATTTCATCCATCACCCTA
                      ____________________________________________________________
consensus TTGAGTACAAAGCATTTTAATCTTCCTGAATAATCAGTTGCAATTTCATCCATCACCCTA
 
. : . : . : . : . : . :
rJMFF020N11- TGGACCATCCGGCAGGGGCCGCACCAACTTGCATAAAATTCAACAAGAACAGGGACATCG
JMFN033E07+ TGGACCATCCGGCAGGGGCCGCACCAACTTGCATAAAATTCAACAAGAACAGGGACATCG
JMFN030M16+ TGGACCATCCGGCAGGGGCCGCACCAACTTGCATAAAATTCAACAAGAACAGGGACATCG
JMFF020N11+ GACCNTCCGGCAGGGGCCGCNCCAACTTGCATAAAATTCAACAAGAACAGGGACATCG
                      ____________________________________________________________
consensus TGGACCATCCGGCAGGGGCCGCACCAACTTGCATAAAATTCAACAAGAACAGGGACATCG
 
. : . : . : . : . : . :
rJMFF020N11- CTGTTCAAAATCATTTTGTCCCATGACTTGCCAGTCACGACTGCAGCTTTGG
JMFN033E07+ CTGTTCAAAATCATTTTGTCCCATGACTTGCCAGTCACGACTGCAGCTTTGGCGTCACGA
JMFN030M16+ CTGTTCAAAATCATTTTGTCCCATGACTTGCCAGTCACGACTGCAGCTTTGGCGTCACGA
JMFF020N11+ CTGTTCAAAATCATTTTGTCCCATGACTTGCCAGTCACGACTGCAGCTTTGGCGTCNCGA
                      ____________________________________________________________
consensus CTGTTCAAAATCATTTTGTCCCATGACTTGCCAGTCACGACTGCAGCTTTGGCGTCACGA
 
. : . : . : . : . : . :
JMFN033E07+ TGGCAGACCACGCGTAAATGGAAGGGGGACTTAGATTGTCGAGGCCTAACGTTCCGGTTG
JMFN030M16+ TGGCAGACCACGCGTAAATGGAAGGGGGACTTAGATTGTCGAGGCCTAACGTTCCGGTTG
JMFF020N11+ TGGCAGACCNCGCGTAAATGGAAGGGGGACTTAGATTGTCGAGGCCTAACGTTCCGGTTG
                      ____________________________________________________________
consensus TGGCAGACCACGCGTAAATGGAAGGGGGACTTAGATTGTCGAGGCCTAACGTTCCGGTTG
 
. : . : . : . : . : . :
JMFN033E07+ AGCAGAAAGGAGCTGCCGATGCTTGCTCCGTTCAACTGCGGTGGAGAATTGGACGGTAAC
JMFN030M16+ AGCAGAAAGGAGCTGCCGATGCTTGCTCCGTTCAACTGCGGTGGAGAATTGGACGGTAAC
JMFF020N11+ AGCAGAAAGGAGCTGCCGATGCTTGCTCCGTTCAACTGCGGTGGAGAATTGGACGGTAAC
                      ____________________________________________________________
consensus AGCAGAAAGGAGCTGCCGATGCTTGCTCCGTTCAACTGCGGTGGAGAATTGGACGGTAAC
 
. : . : . : . : . : . :
JMFN033E07+ GAACAGAGCGATCGTCGGC
JMFN030M16+ GAACAGAGCGATCGTCGGCGGAGAGACGGAGGGAGCTGTATAAAGGGAGGAGTGATGAAG
JMFF020N11+ GAACAGAGCGATNGTCGGCGGAGAGACGGAGGGAGCTGTATAAAGGGAGGAGTGATGAAG
                      ____________________________________________________________
consensus GAACAGAGCGATCGTCGGCGGAGAGACGGAGGGAGCTGTATAAAGGGAGGAGTGATGAAG
 
. : . : . : . : . : . :
JMFN030M16+ TATAGAGAAGTAGCCATTTACGCCCTCAAAATCTCAAAAAAAAAAAATGCAGAGATCATC
JMFF020N11+ TATAGAGAAGTAGCCATTTACGCCCTCAAAATNTC-AAAAAAAAAAATGCAGAGATCATC
                      ____________________________________________________________
consensus TATAGAGAAGTAGCCATTTACGCCCTCAAAATCTCAAAAAAAAAAAATGCAGAGATCATC
 
. : . : . : . : . : . :
JMFN030M16+ CGTATATATCTTTCGCCGCAAA
JMFF020N11+ CGTATATATCTTTCGCCGCAAATATCTTTCAAATGAAAATCGACGTTTTCTTTGAGCAGC
                      ____________________________________________________________
consensus CGTATATATCTTTCGCCGCAAATATCTTTCAAATGAAAATCGACGTTTTCTTTGAGCAGC