Previous Contig 001041:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020M21Sequence477001041 (3)714009176 (2)pir|G96587|G965871e-59hypothetical protein T22H22.2 [imported] - Arabidopsis thaliana>gb:AE005173_8933
JMFS020F09Sequence468001041 (3)pir|G96587|G965870.012hypothetical protein T22H22.2 [imported] - Arabidopsis thaliana>gb:AE005173_8933
JMSF026L16Sequence636001041 (3)pir|G96587|G965875e-21hypothetical protein T22H22.2 [imported] - Arabidopsis thaliana>gb:AE005173_8933752009176 (2)pir|G96587|G965874e-81hypothetical protein T22H22.2 [imported] - Arabidopsis thaliana>gb:AE005173_8933

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026L16+ CTTATGG
                      ____________________________________________________________
consensus CTTATGG
 
. : . : . : . : . : . :
JMSF026L16+ TGCAATGTGAGACNTAATCCTGTTCCATCGGCTCCAGGTAAGAAGAACAGAGCAGGTGAG
                      ____________________________________________________________
consensus TGCAATGTGAGACNTAATCCTGTTCCATCGGCTCCAGGTAAGAAGAACAGAGCAGGTGAG
 
. : . : . : . : . : . :
JMFS020F09+ AGGTCCACCAACAGGT
JMSF026L16+ TCTTTTAAATGAGGAGCACAAGAGANTGGTGCAAACCACCTTGGAGGTCCACCATCAGGC
                      ____________________________________________________________
consensus TCTTTTAAATGAGGAGCACAAGAGANTGGTGCAAACCACCTTGGAGGTCCACCATCAGGT
 
. : . : . : . : . : . :
JMFS020F09+ TCAATAATCTATGTGATTAATACAAGATAATCCTTTACAGTGTTAGTACCATATCAATAA
JMSF026L16+ TCAATAATCTCTTTGGNTAATTCAAGATAATCCTTCACAGTTTGAGTCCCATATCCATCA
                      ____________________________________________________________
consensus TCAATAATCTCTTTGGTTAATTCAAGATAATCCTTTACAGTTTTAGTCCCATATCCATCA
 
. : . : . : . : . : . :
JMFS020F09+ TCCCAGTAAACTGCCATTTTCTGTTGCCCACAATCTTTCTTCTTGTTCTCTTCCAGAACA
JMSF026L16+ TCCCAGTAAACCTCCAACTTTTCTTGACCACAATCCTTCTTCTTCTTCTCCTCCCTAACA
                      ____________________________________________________________
consensus TCCCAGTAAACTTCCATTTTTTGTTGCCCACAATCTTTCTTCTTGTTCTCTTCCCTAACA
 
. : . : . : . : . : . :
JMFS020F09+ ATAACACGTGACCTCAAATACCCATTTCCCACATCAATAGAAGCCCAACCACTTCTCCCC
JMSF026L16+ CTAACACCTGACCTCAAATACCCATTTCCCACATCAATTGAAGCCCTACCACTTCTCCCC
                      ____________________________________________________________
consensus CTAACACGTGACCTCAAATACCCATTTCCCACATCAATTGAAGCCCTACCACTTCTCCCC
 
. : . : . : . : . : . :
JMFS020F09+ TTGTCCCCCACAGGTGAAACACCATTTACTCCAACAGAATCAGACAGCATATATGATGAA
JMSF026L16+ TTCTCCCCCACAGGTGAAACACCATTTACTCCAACAGAATCAGACAACAAATCTGCTGAA
JMFF020M21+ TCCCCCACAGGTGAAACACCATTTACTCCAACAGAATCAGACAACAAATCTGCTGAA
                      ____________________________________________________________
consensus TTGTCCCCCACAGGTGAAACACCATTTACTCCAACAGAATCAGACAACAAATCTGCTGAA
 
. : . : . : . : . : . :
JMFS020F09+ TCCCCCCGGCTCGCTATACAATGAACACTAGTTGTAGGTCGCAGGTTAGACTCCGAATTC
JMSF026L16+ TCCCCCCGGCTCGCTATACACTGAATACTAGTTCTAGGTTGCAGCTTAGACTCCAAATTC
JMFF020M21+ TCCCCCCGGCTCGCTATACACTGAATACTAGTTCTAGGTTGCAGCTTAGACTCCAAATTC
                      ____________________________________________________________
consensus TCCCCCCGGCTCGCTATACACTGAATACTAGTTCTAGGTTGCAGCTTAGACTCCAAATTC
 
. : . : . : . : . : . :
JMFS020F09+ AAATAAAAGCTAGGTTATATGCTTGAAGCTCTGCACAATTAAACCCATGATTTTTGATAA
JMSF026L16+ AAAGAAAAACAAGGTGATAT-CTTGAAGCTCTGCACAACTAAAGCCATGATTTTTGAAAA
JMFF020M21+ AAAGAAAAACAAGGTGATAT-CTTGAAGCTCTGCACAACTAAAGCCATGATTTTTGAAAA
                      ____________________________________________________________
consensus AAAGAAAAACAAGGTGATAT-CTTGAAGCTCTGCACAACTAAAGCCATGATTTTTGAAAA
 
. : . : . : . : . : . :
JMFS020F09+ CCAATCTTTTCAAAC
JMSF026L16+ CCAATCTTTTCAAACTGAAGATAAAATGGGAGAGGATGAACTCTCAAGAATGAAATCATG
JMFF020M21+ CCAATCTTTTCAAACTGAAGATAAAATGGGAGAGGATGAACTCTCAAGAATGAAATCATG
                      ____________________________________________________________
consensus CCAATCTTTTCAAACTGAAGATAAAATGGGAGAGGATGAACTCTCAAGAATGAAATCATG
 
. : . : . : . : . : . :
JMSF026L16+ AATATGCCAAAATTGAAGCAAGCTCTCAACCAGAGCCTTTCGAAAATGTGATTTTCTGTC
JMFF020M21+ AATATGCCAAAATTGAAGCAAGCTCTCAACCAGAGCCTTTCGAAAATGTGATTTTCTGTC
                      ____________________________________________________________
consensus AATATGCCAAAATTGAAGCAAGCTCTCAACCAGAGCCTTTCGAAAATGTGATTTTCTGTC
 
. : . : . : . : . : . :
JMSF026L16+ TGAACTAAATTAGAAAGTCAGGGCTGCCC
JMFF020M21+ TGAACTAAATTAGAAAGTCAGGGCTGCCCAGCACATGGAACTTTTTTCTCAAGTGTTTTA
                      ____________________________________________________________
consensus TGAACTAAATTAGAAAGTCAGGGCTGCCCAGCACATGGAACTTTTTTCTCAAGTGTTTTA
 
. : . : . : . : . : . :
JMFF020M21+ AACCACAAAAAGAAAGGTGAAAGTGAAATCCCAGAATTTTGTGATACCTCAAAGTTTAAA
                      ____________________________________________________________
consensus AACCACAAAAAGAAAGGTGAAAGTGAAATCCCAGAATTTTGTGATACCTCAAAGTTTAAA
 
. : . : . : . : . : . :
JMFF020M21+ GATTTATAGGAATATGAACAAGCAAGAAACAGACTGTGTTTGTGTGTGGATCCAAAACAT
                      ____________________________________________________________
consensus GATTTATAGGAATATGAACAAGCAAGAAACAGACTGTGTTTGTGTGTGGATCCAAAACAT