Previous Contig 001029:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020G13Sequence552001029 (7)gb:AJ841794_18144112e-24Populus x canadensis mRNA for putative histidine-containing phosphotransfer prot686001029 (7)gb:AF346308_17899515e-60Catharanthus roseus histidine-containing phosphotransfer protein mRNA, complete
JMFN002B07Sequence601001029 (7)gb:AF346308_17899514e-61Catharanthus roseus histidine-containing phosphotransfer protein mRNA, complete
JMSF015L18Sequence530001029 (7)gb:AF346308_17899513e-58Catharanthus roseus histidine-containing phosphotransfer protein mRNA, complete 599001029 (7)gb:AF346308_17899514e-58Catharanthus roseus histidine-containing phosphotransfer protein mRNA, complete
JMSF021E22Sequence635001029 (7)gb:AF346308_17899514e-53Catharanthus roseus histidine-containing phosphotransfer protein mRNA, complete 761001029 (7)gb:AF346308_17899516e-61Catharanthus roseus histidine-containing phosphotransfer protein mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020G13- CGGGTTTCAGAATGACAAAA
rJMSF021E22- GCAGCAGCAACATCGGGTTTCAGAATGACAAAA
                      ____________________________________________________________
consensus GCAGCAGCAACATCGGGTTTCAGAATGACAAAA
 
. : . : . : . : . : . :
rJMFF020G13- ATCACTTCATAAAAAGATGATAGCACTGCATGACATGGTCACCAAATTGTACAAGAAGAA
rJMSF015L18- GCATGACATGGTCACCAAATTGTACAAGAAGAA
rJMSF021E22- ATCACTTCATAAAAAGATGATAGCACTGCATGACATGGTCACCAAATTGTACAAGAAGAA
                      ____________________________________________________________
consensus ATCACTTCATAAAAAGATGATAGCACTGCATGACATGGTCACCAAATTGTACAAGAAGAA
 
. : . : . : . : . : . :
rJMFF020G13- CAGATCTGAGTAGCTCTTAGAGAACCTCTTAATTTAATTAGTAATTTTGTTACTAAACAC
rJMSF015L18- CAGATCTGAGTAGCTCTTAGAGAACCTCTTAATTTAATTAGTAATTTTGTTACTAAACAC
JMSF015L18+ ATTAGTAATTTTGTTACTAAACAC
rJMSF021E22- CAGATCTGAGTAGCTCTTAGAGAACCTCTTAATTTAATTAGTAATTTTGTTACTAAACAC
                      ____________________________________________________________
consensus CAGATCTGAGTAGCTCTTAGAGAACCTCTTAATTTAATTAGTAATTTTGTTACTAAACAC
 
. : . : . : . : . : . :
rJMFF020G13- AGCAACTCACAAAGTTGTCCACACCACAGCCTTAGCTTAATTCCTAGTATTATTGTTTGC
rJMSF015L18- AGCAACTCACAAAGTTGTCCACACCACAGCCTTAGCTTAATTCCTAGTATTATTGTTTGC
JMSF015L18+ AGCAACTCACAAAGTNGTCCACACCACAGCCTTAGCTTAATTCCTAGTATTATTGTTTGC
rJMSF021E22- AGCAACTCACAAAGTTGTCCACACCACAGCCTTAGCTTAATTCCTAGTATTATTGTTTGC
JMFN002B07+ AAAGTTGTCCACACCACAGCCTTAGCTTAATTCCTAGTATTATTGTTTGC
                      ____________________________________________________________
consensus AGCAACTCACAAAGTTGTCCACACCACAGCCTTAGCTTAATTCCTAGTATTATTGTTTGC
 
. : . : . : . : . : . :
rJMFF020G13- TTATGTTTTTATTCAAATATTGGAATTGCTCCACCTGCTGCCACAATCTGCTGCTCCAAC
rJMSF015L18- TTATGTTTTTATTCAAATATTGGAATTGCTCCACCTGCTGCCACAATCTGCTGCTCCAAC
JMSF015L18+ TTATGTTTTTATTCAAATATNGGAATTGCTCCACCTGCTGCCACAATCTGCTGCTCCAAC
rJMSF021E22- TTATGTTTTTATTCAAATATTGGAATTGCTCCACCTGCTGCCACAATCTGCTGCTCCAAC
JMFN002B07+ TTATGTTTTTATTCAAATATTGGAATTGCTCCACCTGCTGCCACAATCTGCTGCTCCAAC
                      ____________________________________________________________
consensus TTATGTTTTTATTCAAATATTGGAATTGCTCCACCTGCTGCCACAATCTGCTGCTCCAAC
 
. : . : . : . : . : . :
rJMFF020G13- CTGAATAAAGTTTCAAGCTTGTTCTTGACTAGCAAGTACTCTTGTTTTACTTGTTGCAAG
rJMSF015L18- CTGAATAAAGTTTCAAGCTTGTTCTTGACTAGCAAGTACTCTTGTTTTACTTGTTGCAAG
JMSF015L18+ CTGAATAAAGTTTCAAGCTTGTTCTTGACTAGCAAGTACTCTTGTTTTACTTGTTGCAAG
rJMSF021E22- CTGAATAAAGTTTCAAGCTTGTTCTTGACTAGCAAGTACTCTTGTTTTACTTGTTGCAAG
JMFN002B07+ CTGAATAAAGTTTCAAGCTTGTTCTTGACTAGCAAGTACTCTTGTTTTACTTGTTGCAAG
JMSF021E22+ GAATAAAGTTTCAAGCTTGTTCTTGACTAGCAAGTACTCTTGTTTTACTTGTTGCAAG
                      ____________________________________________________________
consensus CTGAATAAAGTTTCAAGCTTGTTCTTGACTAGCAAGTACTCTTGTTTTACTTGTTGCAAG
 
. : . : . : . : . : . :
rJMFF020G13- CATCTCAAGCTCCCTTCAATGTTGTGTTCTTCACAGAAGTTGCGAAAAGCAACGCAGACA
rJMSF015L18- CATCTCAAGCTCCCTTCAATGTTGTGTTCTTCACAGAAGTTGCGAAAAGCAACGCAGACA
JMSF015L18+ CATCTCAAGCTCCCTTCAATGTTGTGTTCTTCACAGAAGTTGCGAAAAGCAACGCAGACA
rJMSF021E22- CATCTCAAGCTCCCTTCAATGTTGTGTTCTTCACAGAAGTTGCGAAAAGCAACGCAGACA
JMFN002B07+ CATCTCAAGCTCCCTTCAATGTTGTGTTCTTCACAGAAGTTGCGAAAAGCAACGCAGACA
JMSF021E22+ CATCTCAAGCTCCCTTCAATGTTGTGTTCTTCACAGAAGTTGCGAAAAGCAACGCAGACA
                      ____________________________________________________________
consensus CATCTCAAGCTCCCTTCAATGTTGTGTTCTTCACAGAAGTTGCGAAAAGCAACGCAGACA
 
. : . : . : . : . : . :
rJMFF020G13- TTCTTCACTCTCTGAGCACCTATGCTTGAGCTGCTACCTTTGAGCTGGTGAACATGAGCA
rJMSF015L18- TTCTTCACTCTCTGAGCACCTATGCTTGAGCTGCTACCTTTGAGCTGGTGAACATGAGCA
JMSF015L18+ TTCTTCACTCTCTGAGCACCTATGCTTGAGCTGCTACCTTTGAGCTGGTGAACATGAGCA
rJMSF021E22- TTCTTCACTCTCTGAGCACCTATGCTTGAGCTGCTACCTTTGAGCTGGTGAACATGAGCA
JMFN002B07+ TTCTTCACTCTCTGAGCACCTATGCTTGAGCTGCTACCTTTGAGCTGGTGAACATGAGCA
JMSF021E22+ TTCTTCACTCTCTGAGCACCTATGCTTGAGCTGCTACCTTTGAGCTGGTGAACATGAGCA
JMFF020G13+ TGAACATGAGCA
                      ____________________________________________________________
consensus TTCTTCACTCTCTGAGCACCTATGCTTGAGCTGCTACCTTTGAGCTGGTGAACATGAGCA
 
. : . : . : . : . : . :
rJMFF020G13- TCAACCTTCTTAAAGTCCACATCTGGCTGAGTAAGAGTTGTGTTGAGATCATTGAGTAGT
rJMSF015L18- TCAACCTTCTTAAAGTCCACATCTGGCTGAGTAAGAGTTGTGTTGAGATCATTGAGTAGT
JMSF015L18+ TCAACCTTCTTAAAGTCCACATCTGGCTGAGTAAGAGTTGTGTTGAGATCATTGAGTAGT
rJMSF021E22- TCAACCTTCTTAAAGTCCACATCTGGCTGAGTAAGAGTTGTGTTGAGATCATTGAGTAGT
JMFN002B07+ TCAACCTTCTTAAAGTCCACATCTGGCTGAGTAAGAGTTGTGTTGAGATCATTGAGTAGT
JMSF021E22+ TCAACCTTCTTAAAGTCCACATCTGGCTGAGTAAGAGTTGTGTTGAGATCATTGAGTAGT
JMFF020G13+ TCAACCTTCTTAAAGTCCACATCTGGCTGAGTAAGAGTTGTGTTGAGATCATTGAGTAGT
                      ____________________________________________________________
consensus TCAACCTTCTTAAAGTCCACATCTGGCTGAGTAAGAGTTGTGTTGAGATCATTGAGTAGT
 
. : . : . : . : . : . :
rJMFF020G13- CTTTCAGAATCTTCAAAGAAGAGAGTCACAACTTCAGCTACAAAAGTANGGTTGCTTTCA
rJMSF015L18- CTTTCAGAATCTTCAAAGAAGAGAGTCACAACTTCAGCTACAAAAGTAGGGTTGCTTTCA
JMSF015L18+ CTTTCAGAATCTTCAAAGAAGAGAGTCACAACTTCAGCTACAAAAGTAGGGTTGCTTTCA
rJMSF021E22- CTTTCAGAATCTTCAAAGAAGAGAGTCACAACTTCAGCTACAAAAGTAGGGTTGCTTTCA
JMFN002B07+ CTTTCAGAATCTTCAAAGAAGAGAGTCACAACTTCAGCTACAAAAGTAGGGTTGCTTTCA
JMSF021E22+ CTTTCAGAATCTTCAAAGAAGAGAGTCACAACTTCAGCTACAAAAGTAGGGTTGCTTTCA
JMFF020G13+ CTTTCAGAATCTTCAAAGAAGAGAGTCACAACTTCAGCTACAAAAGTAGGGTTGCTTTCA
                      ____________________________________________________________
consensus CTTTCAGAATCTTCAAAGAAGAGAGTCACAACTTCAGCTACAAAAGTAGGGTTGCTTTCA
 
. : . : . : . : . : . :
rJMFF020G13- TCCTGAAGTTGCTGGAGCTGACTAAACTGAGCATCCAAGAATCCCTCACGAAATAATTCT
rJMSF015L18- TCCTGAAGTTGCTGGAGCTGACTAAACTGAGCATCCAAGAATCCCTCACGAAATAATTCT
JMSF015L18+ TCCTGAAGTTGCTGGAGCTGACTAAACTGAGCATCCAAGAATCCCTCACGAAATAATTCT
rJMSF021E22- TCCTGAAGTTGCTGGAGCTGACTAAACTGAGCATCCAAGAATCCCTCACGAAATAATTCT
JMFN002B07+ TCCTGAAGTTGCTGGAGCTGACTAAACTGAGCATCCAAGAATCCCTCACGAAATAATTCT
JMSF021E22+ TCCTGAAGTTGCTGGAGCTGACTAAACTGAGCATCCAAGAATCCCTCACGAAATAATTCT
JMFF020G13+ TCCTGAAGTTGCTGGAGCTGACTAAACTGAGCATCCAAGAATCCCTCACGAAATAATTCT
                      ____________________________________________________________
consensus TCCTGAAGTTGCTGGAGCTGACTAAACTGAGCATCCAAGAATCCCTCACGAAATAATTCT
 
. : . : . : . : . : . :
rJMFF020G13- GTCATGTACCCAAGAAAACTGCTCTGCAATTGGCTCACCTCCATCTCTGCACCTCTTTCT
rJMSF015L18- GTCATGTACCCAAGAAAACTGCTCT
JMSF015L18+ GTCATGTACCCAAGAAAACTGCTCT
rJMSF021E22- GTCATGTACCCAAGAAAACTGCTCTGCAATTGGCTCACCTCCATCTCTGCACCTCTTTCT
JMFN002B07+ GTCATGTACCCAAGAAAACTGCTCTGCAATTGGCTCACCTCCATCTCTGCACCTCTTTCT
JMSF021E22+ GTCATGTACCCAAGAAAACTGCTCTGCAATTGGCTCACCTCCATCTCTGCACCTCTTTCT
JMFF020G13+ GTCATGTACCCAAGAAAACTGCTCTGCAATTGGCTCACCTCCATCTCTGCACCTCTTTCT
                      ____________________________________________________________
consensus GTCATGTACCCAAGAAAACTGCTCTGCAATTGGCTCACCTCCATCTCTGCACCTCTTTCT
 
. : . : . : . : . : . :
rJMFF020G13- TTCTTT
rJMSF021E22- TTCTTTGTTTGTTTTTAACTTGTTCTTTGGGGGTGACAGTCACCAATACTGAAAAGTTGT
JMFN002B07+ TTCTTTGTTTGTTTTTAACTTGTTCTTTGGGGGTGACAGTCACCAATACTGAAAAGTTGT
JMSF021E22+ TTCTTTGTTTGTTTTTAACTTGTTCTTTGGGGGTGACAGTCACCAATACTGAAAAGTTGT
JMFF020G13+ TTCTTTGTTTGTTTTTAACTTGTTCTTTGGGGGTGACAGTCACCAATACTGAAAAGTTGT
                      ____________________________________________________________
consensus TTCTTTGTTTGTTTTTAACTTGTTCTTTGGGGGTGACAGTCACCAATACTGAAAAGTTGT
 
. : . : . : . : . : . :
rJMSF021E22- TGGAGGGG
JMFN002B07+ TGGAGGGG
JMSF021E22+ TGGAGGGGAGAGAGATAGATCTTGGGAAATAAATGCGGAGAGAAGGGGATTTGGTGAAAT
JMFF020G13+ TGGAGGGGAGAGAGATAGATCTTGGGAAATAAATGCGGAGAGAAGGGGATTTGGTGAAAT
                      ____________________________________________________________
consensus TGGAGGGGAGAGAGATAGATCTTGGGAAATAAATGCGGAGAGAAGGGGATTTGGTGAAAT
 
. : . : . : . : . : . :
JMSF021E22+ GAATGAGGAGACAGAGAGATAGAGATAGAGATAGAGAGAGAGGGGGAAAGATCCAAAAAT
JMFF020G13+ GAATGAGGAGACAGAGAGATAGAGATAGAGATAGAGAGAGAGGGGGAAAGATCCAAAAAT
                      ____________________________________________________________
consensus GAATGAGGAGACAGAGAGATAGAGATAGAGATAGAGAGAGAGGGGGAAAGATCCAAAAAT
 
. : . : . : . : . : . :
JMSF021E22+ GTATTTCCTGGTTTTAGGGTATTGGGATTTGGTCT
JMFF020G13+ GTATTTCCTGGTTTTAGGGTATTGGGATTTGGTCTAGGTGCGCAGTAGAAATTACACAAT
                      ____________________________________________________________
consensus GTATTTCCTGGTTTTAGGGTATTGGGATTTGGTCTAGGTGCGCAGTAGAAATTACACAAT
 
. : . : . : . : . : . :
JMFF020G13+ GAAAGCTAATCCTTTTTCCTTTTCCTCTCTGTTTTCTCTGGATTTGTGTTACGTCCTTTC
                      ____________________________________________________________
consensus GAAAGCTAATCCTTTTTCCTTTTCCTCTCTGTTTTCTCTGGATTTGTGTTACGTCCTTTC