Previous Contig 001028:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020G12Sequence622001028 (2)gb:AY372537_16032521e-68Cucumis sativus ubiquitin extension protein mRNA, complete cds.608001028 (2)gb:AY372537_16032521e-68Cucumis sativus ubiquitin extension protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020G12+ ACGC
JMFF020G12- GGTGTGAGCGGAGACGCGACGC
                      ____________________________________________________________
consensus GGTGTGAGCGGAGACGCGACGC
 
. : . : . : . : . : . :
rJMFF020G12+ GAAAATGCAGATCTTTGTGAAGACCCTGACGGGGAAGACGATAACCCTAGAGGTCGAGTC
JMFF020G12- GAAAATGCAGATCTTTGTGAAGACCCTGACGGGGAAGACGATAACCCTAGAGGTCGAGTC
                      ____________________________________________________________
consensus GAAAATGCAGATCTTTGTGAAGACCCTGACGGGGAAGACGATAACCCTAGAGGTCGAGTC
 
. : . : . : . : . : . :
rJMFF020G12+ ATCGGACACCATTGACAATGTGAAGGCGAAAATCCAGGACAAGGAGGGCATCCCACCAGA
JMFF020G12- ATCGGACACCATTGACAATGTGAAGGCGAAAATCCAGGACAAGGAGGGCATCCCACCAGA
                      ____________________________________________________________
consensus ATCGGACACCATTGACAATGTGAAGGCGAAAATCCAGGACAAGGAGGGCATCCCACCAGA
 
. : . : . : . : . : . :
rJMFF020G12+ CCAGCAACGCCTCATCTTCGCCGGAAAGTAGCTCGAGGACGGGCGCACCCTTGCAGACTA
JMFF020G12- CCAGCAACGCCTCATCTTCGCCGGAAAGTAGCTCGAGGACGGGCGCACCCTTGCAGACTA
                      ____________________________________________________________
consensus CCAGCAACGCCTCATCTTCGCCGGAAAGTAGCTCGAGGACGGGCGCACCCTTGCAGACTA
 
. : . : . : . : . : . :
rJMFF020G12+ CAACATCCAAAAGGATTCTACCCTCCACCTCGTCCTTCGCCTCCGCGGCGGGGCAAAGAA
JMFF020G12- CAACATCCAAAAGGATTCTACCCTCCACCTCGTCCTTCGCCTCCGCGGCGGGGCAAAGAA
                      ____________________________________________________________
consensus CAACATCCAAAAGGATTCTACCCTCCACCTCGTCCTTCGCCTCCGCGGCGGGGCAAAGAA
 
. : . : . : . : . : . :
rJMFF020G12+ GCGCAAGAAGAAGACATACACGAAGCCCAAAAAGATTAAGCACAAACACAAGAAGGTGAA
JMFF020G12- GCGCAAGAAGAAGACATACACGAAGCCCAAAAAGATTAAGCACAAACACAAGAAGGTGAA
                      ____________________________________________________________
consensus GCGCAAGAAGAAGACATACACGAAGCCCAAAAAGATTAAGCACAAACACAAGAAGGTGAA
 
. : . : . : . : . : . :
rJMFF020G12+ GCTCGCCGTCTTGCAGTTCTACAAGGTTGATGATTCTGGAAAAGTACAGAGGCTCCGTAA
JMFF020G12- GCTCGCCGTCTTGCAGTTCTACAAGGTTGATGATTCTGGAAAAGTACAGAGGCTCCGTAA
                      ____________________________________________________________
consensus GCTCGCCGTCTTGCAGTTCTACAAGGTTGATGATTCTGGAAAAGTACAGAGGCTCCGTAA
 
. : . : . : . : . : . :
rJMFF020G12+ AGAGTGCCCCAACGCGGAGTGCGGTGCTGGCACATTCATGGCCAACCATTTTGACAGGCA
JMFF020G12- AGAGTGCCCCAACGCGGAGTGCGGTGCTGGCACATTCATGGCCAACCATTTTGACAGGCA
                      ____________________________________________________________
consensus AGAGTGCCCCAACGCGGAGTGCGGTGCTGGCACATTCATGGCCAACCATTTTGACAGGCA
 
. : . : . : . : . : . :
rJMFF020G12+ CTACTGTGGCAAATGTGGGCTTACCTATGTCTA
JMFF020G12- CTACTGTGGCAAATGTGGGCTTACCTATGTCTATCATAAGGCTGGCGGTGACTGATACTT
                      ____________________________________________________________
consensus CTACTGTGGCAAATGTGGGCTTACCTATGTCTATCATAAGGCTGGCGGTGACTGATACTT
 
. : . : . : . : . : . :
JMFF020G12- TTCTTCTACTTTCATTTCATTATGAATCCTTTATATAATTTTAGACCGTGATGTTTGGCC
                      ____________________________________________________________
consensus TTCTTCTACTTTCATTTCATTATGAATCCTTTATATAATTTTAGACCGTGATGTTTGGCC
 
. : . : . : . : . : . :
JMFF020G12- GTATAATGGTTTTGAAACTCTTTTGGCTTTTTCCAAATCCTATTTTCCTGCTATATTTTG
                      ____________________________________________________________
consensus GTATAATGGTTTTGAAACTCTTTTGGCTTTTTCCAAATCCTATTTTCCTGCTATATTTTG