Previous Contig 001027:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006E17Sequence502001027 (34)sp|P27081|ADT2_SOLTU4e-51ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 771001027 (34)gb:LAAJ3197_16838783e-93Lupinus albus mRNA for adenine nucleotide translocator.
JMFF006G08Sequence731001027 (34)gb:LAAJ3197_16838781e-80Lupinus albus mRNA for adenine nucleotide translocator.
JMFF016I03Sequence506001027 (34)sp|P27081|ADT2_SOLTU4e-53ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 780001027 (34)gb:AX172679_14630611e-73Sequence 169 from Patent WO0144476.
JMFF020G01Sequence502001027 (34)sp|P27081|ADT2_SOLTU6e-52ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 729001027 (34)gb:LAAJ3197_16838789e-85Lupinus albus mRNA for adenine nucleotide translocator.
JMFF026L14Sequence552001027 (34)sp|P27081|ADT2_SOLTU2e-61ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 764001027 (34)gb:LAAJ3197_16838783e-85Lupinus albus mRNA for adenine nucleotide translocator.
JMFF027E03Sequence502001027 (34)sp|P27081|ADT2_SOLTU6e-52ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 743001027 (34)gb:LAAJ3197_16838782e-93Lupinus albus mRNA for adenine nucleotide translocator.
JMFF031I20Sequence585001027 (34)sp|P27081|ADT2_SOLTU8e-71ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 705001027 (34)gb:LAAJ3197_16838787e-82Lupinus albus mRNA for adenine nucleotide translocator.
JMFF031P05Sequence507001027 (34)sp|P27081|ADT2_SOLTU8e-52ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 756001027 (34)gb:LAAJ3197_1683878e-111Lupinus albus mRNA for adenine nucleotide translocator.
JMFF035N07Sequence538001027 (34)sp|P27081|ADT2_SOLTU3e-54ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 736001027 (34)gb:LAAJ3197_16838788e-86Lupinus albus mRNA for adenine nucleotide translocator.
JMFF037B06Sequence535001027 (34)sp|P27081|ADT2_SOLTU2e-58ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 770001027 (34)gb:LAAJ3197_16838783e-93Lupinus albus mRNA for adenine nucleotide translocator.
JMFF037P13Sequence535001027 (34)sp|P27081|ADT2_SOLTU3e-54ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 692021532sp|P31167|ADT1_ARATH8e-72ADP,ATP carrier protein 1, mitochondrial precursor (ADP/ATP translocase 1) (Aden
JMFF038E01Sequence515001027 (34)sp|P27081|ADT2_SOLTU5e-54ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 722001027 (34)gb:LAAJ3197_16838782e-85Lupinus albus mRNA for adenine nucleotide translocator.
JMFF038J18Sequence583001027 (34)sp|P27081|ADT2_SOLTU2e-68ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 694001027 (34)gb:LAAJ3197_16838785e-80Lupinus albus mRNA for adenine nucleotide translocator.
JMFF040F24Sequence536001027 (34)sp|P27081|ADT2_SOLTU1e-57ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 809001027 (34)gb:LAAJ3197_16838782e-92Lupinus albus mRNA for adenine nucleotide translocator.
JMFF049J13Sequence616001027 (34)sp|P27081|ADT2_SOLTU1e-74ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 530011225 (3)
JMFF050N15Sequence613001027 (34)sp|P27081|ADT2_SOLTU5e-74ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 525011225 (3)
JMFN025A03Sequence628001027 (34)sp|P27081|ADT2_SOLTU7e-82ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMFN036C07Sequence548001027 (34)sp|P31167|ADT1_ARATH1e-53ADP,ATP carrier protein 1, mitochondrial precursor (ADP/ATP translocase 1) (Aden
JMFS081G01Sequence601001027 (34)sp|P27081|ADT2_SOLTU3e-78ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMSF050F06Sequence713001027 (34)sp|P27081|ADT2_SOLTU2e-95ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine 793001027 (34)gb:LAAJ3197_16838788e-93Lupinus albus mRNA for adenine nucleotide translocator.
JMSF051F06Sequence694001027 (34)gb:LAAJ3197_16838781e-66Lupinus albus mRNA for adenine nucleotide translocator.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006G08- ACGGAGTACTAATCCCAGATCAAG
rJMFF026L14- CAGATTAAACGGAGTACTAATCCCAAATCAA-
                      ____________________________________________________________
consensus CAGATTAAACGGAGTACTAATCCCAGATCAAG
 
. : . : . : . : . : . :
rJMFF006G08- ACTCATAAATTATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMFF026L14- ACTCATAAATTATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMFF035N07- ACTCATAAATTATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMFF027E03- AGTACGCAAAACAAAATTAC
rJMFF020G01- ATTATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMFF038E01- TACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMFF031I20- AATTATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMFF038J18- TTATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMSF051F06- TACGCAAAACAAAATTGC
JMFN036C07- ACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMFF006E17- AAATTATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMFF037B06- ATTATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMFF016I03- ACTCATAAATTATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMSF050F06- CGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
rJMFF040F24- ATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
                      ____________________________________________________________
consensus ACTCATAAATTATACGAATCTGTAACCTCTCCAGTGCTCAAGTACGCAAAACAAAATTAC
 
. : . : . : . : . : . :
rJMFF006G08- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF026L14- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF035N07- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF027E03- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF020G01- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF038E01- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF031I20- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF038J18- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMSF051F06- NAAATACCCTCNTCGAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAAG
JMFN036C07- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF006E17- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF037B06- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF016I03- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMSF050F06- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
rJMFF040F24- AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
                      ____________________________________________________________
consensus AAAATACCCTCATCAAAAGGGTTGGGGTAAGTTTGGGTTCAAGCAACCCTCATCTAAAA-
 
. : . : . : . : . : . :
rJMFF006G08- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF026L14- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF035N07- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF027E03- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF020G01- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF038E01- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF031I20- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF038J18- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMSF051F06- TTTAATTANTCGAAATGCNTANTAGAGACTTCGGCCTGAANGAATTCTNAAATTGCGNCA
JMFN036C07- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF006E17- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF037B06- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF016I03- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMSF050F06- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF040F24- TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
rJMFF031P05- TAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
                      ____________________________________________________________
consensus TTTAATTATTCAAAATGCATAATAAAAACTTCAGCCTGAATGAATTCTTAAATTGCGACA
 
. : . : . : . : . : . :
rJMFF006G08- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF026L14- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF035N07- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF027E03- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF020G01- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF038E01- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF031I20- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF038J18- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMSF051F06- GATTTNCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACNGAACTTATGCCCCAC
JMFN036C07- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF006E17- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF037B06- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF016I03- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMSF050F06- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF040F24- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
rJMFF031P05- GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
                      ____________________________________________________________
consensus GATTTTCGTCACCATATAACTATGCTACTGAAAAGAGACGCGACCGAACTTATGCCCCAC
 
. : . : . : . : . : . :
rJMFF006G08- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF026L14- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF035N07- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF027E03- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF020G01- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF038E01- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF031I20- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF038J18- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMSF051F06- CAGAGCCANANTTCTTTCCGAAAACTANTAACTGAAGCTTGTCATACCCGGCCAACNCAC
JMFN036C07- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF006E17- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF037B06- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF016I03- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMSF050F06- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF040F24- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
rJMFF031P05- CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
                      ____________________________________________________________
consensus CAGAGCCATACTTCTTTCCGAAAACTATTAACTGAAGCTTGTCATACCCGGCCAACACAC
 
. : . : . : . : . : . :
rJMFF006G08- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF026L14- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF035N07- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF027E03- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF020G01- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF038E01- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF031I20- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF038J18- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMSF051F06- CAGCNCCAGCANTAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
JMFN036C07- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF006E17- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF037B06- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF016I03- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMSF050F06- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF040F24- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
rJMFF031P05- CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
                      ____________________________________________________________
consensus CAGCACCAGCAATAGCACGCAGGATATTTGCACCAGCACCCTTGAAGAGAGATTTCGCAC
 
. : . : . : . : . : . :
rJMFF006G08- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF026L14- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF035N07- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF027E03- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF020G01- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF038E01- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF031I20- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF038J18- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMSF051F06- CTTCATTCTTAAGAATCTGAGCNAAAGCNTCAAGAGAGCTCTTGTACTTGACAGCTTCAC
JMFN036C07- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF006E17- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF037B06- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF016I03- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMSF050F06- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF040F24- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
rJMFF031P05- CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
                      ____________________________________________________________
consensus CTTCATTCTTAAGAATCTGAGCAAAAGCATCAAGAGAGCTCTTGTACTTGACAGCTTCAC
 
. : . : . : . : . : . :
rJMFF006G08- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF026L14- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF035N07- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF027E03- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF020G01- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF038E01- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF031I20- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF038J18- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMSF051F06- CAGATGTCATCATCATTCTTCTGCGGACAGTGNCAATTGGGTAAGAAGCAAGACCAGCAC
JMFN036C07- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF006E17- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF037B06- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF016I03- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMSF050F06- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF040F24- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
rJMFF031P05- CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
                      ____________________________________________________________
consensus CAGATGTCATCATCATTCTTCTGCGGACAGTGTCAATTGGGTAAGAAGCAAGACCAGCAC
 
. : . : . : . : . : . :
rJMFF006G08- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF026L14- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF035N07- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF027E03- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF020G01- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF038E01- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF031I20- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF038J18- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMSF051F06- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
JMFN036C07- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF006E17- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF037B06- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF016I03- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMSF050F06- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF040F24- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
rJMFF031P05- CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
                      ____________________________________________________________
consensus CATTTGTGATGACCCATCCGAGAGCAAAGCTAGCGAAGAAACTATCCTGTAGGTCTCCAG
 
. : . : . : . : . : . :
rJMFF006G08- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF026L14- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF035N07- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF027E03- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF020G01- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF038E01- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF031I20- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF038J18- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMSF051F06- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAGAGTACAACCCACGATACNNAATGA
JMFN036C07- TCAAGACAACTGGCTTAATGGA
rJMFF006E17- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF037B06- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF016I03- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMSF050F06- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF040F24- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
rJMFF031P05- TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
                      ____________________________________________________________
consensus TCAAGACAACTGGCTTAATGGAGTCATACAGTCCAAAGTACAACCCACGATACACAATGA
 
. : . : . : . : . : . :
rJMFF006G08- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF026L14- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF035N07- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF027E03- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF020G01- TACCAACACATGAAATGTTGAATCCTCGGTTGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF038E01- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF031I20- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF038J18- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMSF051F06- TACCAACNCATGAAATGTTGAATCCTCGGTAGAGNCCAGCAATACCATCAGAAGCAAGGG
rJMFF006E17- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF037B06- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF016I03- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCA--ACCATCAGAAGCAAGGG
rJMSF050F06- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF040F24- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
rJMFF031P05- TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
                      ____________________________________________________________
consensus TACCAACACATGAAATGTTGAATCCTCGGTAGAGTCCAGCAATACCATCAGAAGCAAGGG
 
. : . : . : . : . : . :
rJMFF006G08- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCT
rJMFF026L14- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
rJMFF035N07- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
rJMFF027E03- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
rJMFF020G01- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
rJMFF038E01- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
rJMFF031I20- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTA
rJMFF038J18- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCT
rJMSF051F06- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCNTAGCAGCCT
rJMFF006E17- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
rJMFF037B06- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
rJMFF016I03- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
rJMSF050F06- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
rJMFF040F24- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
rJMFF031P05- TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
                      ____________________________________________________________
consensus TCTTTCGGTAGACATCAATCAAACCATTGAACTGTCTCTCACCTCCCTTCTTAGCAGCCT
 
. : . : . : . : . : . :
rJMFF026L14- TGGCATCATTTGCA
rJMFF035N07- TGGCATCATTTGCAAG
rJMFF027E03- TGGCATCATTCGCAAGACGGGTACGAGCATAGTCCAAGGAGTAAACAAAAAGTAATGA
rJMFF020G01- TGGCATCATTTGCAAGAC
rJMFF038E01- TGGCATCATTTGCAA
rJMSF051F06- TGGCATCATTTGCAAG
rJMFF006E17- TGGCATCATTTGCAAGACGGGTACGAGCATAGTCCAAGGAGTAAACAAAAAGTAATGA
rJMFF037B06- TGGCATCATTTGCAAGACGGGTACGAGCATAGTCCAAGGAGTAAACAAAAAGTAATGAG
rJMFF016I03- TGGCATCATTTGCAAGACGGGTACGAGCATAGTCCAAGGAGTAAACAAAAAGTAATGAGG
rJMSF050F06- TGGCATCATTTGCAAGACGGGTACGAGCATAGTCCAAGGAGTAAACAAAAAGTAATGAGG
rJMFF040F24- TGGCATCATTTGCAAGACGGGTACGAGCATAGTCCAAGGAGTAAACAAAAAGTAATGAGG
rJMFF031P05- TGGCATCATTTGCAAGACGGGTACGAGCATAGTCCAAGGAGTAAACAAAAAGTAATGAGG
                      ____________________________________________________________
consensus TGGCATCATTTGCAAGACGGGTACGAGCATAGTCCAAGGAGTAAACAAAAAGTAATGAGG
 
. : . : . : . : . : . :
rJMFF016I03- AAG
rJMSF050F06- AAGCACCAGCAGCACCACCTGA
rJMFF040F24- AAGCACCAGCAGCACCACCTGATGCAAGG
rJMFF031P05- AAGCACCAGCAGCACCACCTGATGCAAGGTTTCCTGCAAACCATTTCCAGTAGCCATCAC
JMSF050F06+ ACCAGCAGCACCACCTGATGCAAGGTTTCCTGCAAACCATTTCCAGTAGCCATCAC
                      ____________________________________________________________
consensus AAGCACCAGCAGCACCACCTGATGCAAGGTTTCCTGCAAACCATTTCCAGTAGCCATCAC
 
. : . : . : . : . : . :
rJMFF031P05- GGTCCTTCTTGAAGTTGAAGAGCCTCTTGAAATAATCCTTGAATGCAAAGTTCAA
JMFS081G01+ TAATCCTTGAATGCAAAGTTCAAGGCCT
JMFN025A03+ TTGAAGTTGAAGAGCCTCTTGAAATAATCCTTGAATGCAAAGTTCAAGGCCT
JMSF050F06+ GGTCCTTCTTGAAGTTGAAGAGCNTCTTGAAATAATCCTTGAATGCAAAGTTCAAGGCCT
JMFF050N15+ TGCAAAGTTCAAGGCNT
JMFF049J13+ TGCAAAGTTCAAGGCCT
                      ____________________________________________________________
consensus GGTCCTTCTTGAAGTTGAAGAGCCTCTTGAAATAATCCTTGAATGCAAAGTTCAAGGCCT
 
. : . : . : . : . : . :
JMFS081G01+ GAGTGGGGAAGTAACGAATGACATTAGCAGTGTTTCCTCTCCACAATGAGGCAAATCCTT
JMFN025A03+ GAGTGGGGAAGTAACGAATGACATTAGCAGTGTTTCCTCTCCACAATGAGGCAAATCCTT
JMSF050F06+ GAGTGGGGAAGTAACGAATGACATTAGCAGTGTTTCCTCTCCACAATGAGGCAAATCCTT
JMFF050N15+ GAGTGGGGAAGTAACGAATGACATTAGCAGTGTTTCCTCTCCACAATGAGGCAAATCCTT
JMFF031I20+ TGGGGAAGTAACGAATGACATTAGCAGTGTTTCCTCTCCACAATGAGGCAAATCCTT
JMFF026L14+ GAGGCAAATCCTT
JMFF038J18+ ACGAATGACATTAGCAGTGTTTCCTCTCCACAATGAGGCAAATCCTT
JMFF049J13+ GAGTGGGGAAGTAACGAATGACATTAGCAGTGTTTCCTCTCCACAATGAGGCAAATCCTT
                      ____________________________________________________________
consensus GAGTGGGGAAGTAACGAATGACATTAGCAGTGTTTCCTCTCCACAATGAGGCAAATCCTT
 
. : . : . : . : . : . :
JMFS081G01+ CATCCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFN025A03+ CATCCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMSF050F06+ CATCCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF050N15+ CATCCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF031I20+ CATCCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF040F24+ CCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF026L14+ CATCCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF038J18+ CATCCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF037B06+ CCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF006E17+ CTTATAAGGCTCAGACAGTCTG
JMFF049J13+ CATCCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF037P13+ TTAATAGTTCGACTGAAACATTCCACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF038E01+ ATTCACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF016I03+ CAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF035N07+ TCCTTAATAGTTCGACTGAAACATTCCACCAATTCCCTTATAAGGCTCAGACAGTCTG
JMFF031P05+ ATTCCCTTATAAGGCTCAGACAGTCTG
JMFF027E03+ CTTATAAGGCTCAGACAGTCTG
JMFF020G01+ CTTATAAGGCTCAGACAGTCTG
                      ____________________________________________________________
consensus CATCCTTAATAGTTCGACTGAAACATT-CACCAATTCCCTTATAAGGCTCAGACAGTCTG
 
. : . : . : . : . : . :
JMFS081G01+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFN025A03+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMSF050F06+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF050N15+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF031I20+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF040F24+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF026L14+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF038J18+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF037B06+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF006E17+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF049J13+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF037P13+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF038E01+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF016I03+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF035N07+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF031P05+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAGGCTTGACGCGCTCAATTGGGGCA
JMFF027E03+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
JMFF020G01+ CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
                      ____________________________________________________________
consensus CCGGTTTTAATCATCTCATCTTGGTTTTGAATCAAAAGCTTGACGCGCTCAATTGGGGCA
 
. : . : . : . : . : . :
JMFS081G01+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFN025A03+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMSF050F06+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF050N15+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF031I20+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF040F24+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF026L14+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF038J18+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF037B06+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF006E17+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF049J13+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF037P13+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF038E01+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF016I03+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF035N07+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF031P05+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF027E03+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
JMFF020G01+ GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
                      ____________________________________________________________
consensus GCTGCAGTCTTTGATACAGCAGCTGAAACTCCACCCATTAGGAAGTCAATAGCAAAGCTG
 
. : . : . : . : . : . :
JMFS081G01+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFN025A03+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMSF050F06+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF050N15+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF031I20+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF040F24+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF026L14+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF038J18+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF037B06+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF006E17+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF049J13+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF037P13+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF038E01+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF016I03+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF035N07+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF031P05+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF027E03+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
JMFF020G01+ GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
                      ____________________________________________________________
consensus GCAAATCCCTTCTCAGCAGGAGCCTGAACAAATACCGGTGAAGCATTTGCAGTAATCAAT
 
. : . : . : . : . : . :
JMFS081G01+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFN025A03+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMSF050F06+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF050N15+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF031I20+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF040F24+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF026L14+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF038J18+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF037B06+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF006E17+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF049J13+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF037P13+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF038E01+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF016I03+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF035N07+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF031P05+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF027E03+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
JMFF020G01+ GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
                      ____________________________________________________________
consensus GACAAATCTTGGGTGGCTTTGCACGACTGAGTCATTGGATACTGTAATCCAGCAGAGCTG
 
. : . : . : . : . : . :
JMFS081G01+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFN025A03+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMSF050F06+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF050N15+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF031I20+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF040F24+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF026L14+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF038J18+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF037B06+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF006E17+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF049J13+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF037P13+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF038E01+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF016I03+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF035N07+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF031P05+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF027E03+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
JMFF020G01+ TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
                      ____________________________________________________________
consensus TAGTTTCCATAAGCAAAATGCCTCTGGTTGAGAACCGGCCTTTGCATGCCGCCATAGCGT
 
. : . : . : . : . : . :
JMFS081G01+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFN025A03+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMSF050F06+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF050N15+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF031I20+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF040F24+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF026L14+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF038J18+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF037B06+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF006E17+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF049J13+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF037P13+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF038E01+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF016I03+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF035N07+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF031P05+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF027E03+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
JMFF020G01+ GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
                      ____________________________________________________________
consensus GTTTGAGCATCTTGGAAAACATTTGAGCTCAGATGGAGCTGGGAAGCTACCTTCTGAGCA
 
. : . : . : . : . : . :
JMFS081G01+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFN025A03+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMSF050F06+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF050N15+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF031I20+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF040F24+ TCAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF026L14+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF038J18+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF037B06+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF006E17+ TCAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF049J13+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF037P13+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF038E01+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF016I03+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF035N07+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF031P05+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF027E03+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
JMFF020G01+ ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
                      ____________________________________________________________
consensus ACAGTTGGGTGTTGATACATATCAGCCATTGCTTTTCAGAACAATCTCCTGCGTTCGACT
 
. : . : . : . : . : . :
JMFS081G01+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAA
JMFN025A03+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGA
JMSF050F06+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGC
JMFF050N15+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCT
JMFF031I20+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAAC
JMFF040F24+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGC
JMFF026L14+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGC
JMFF038J18+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCT
JMFF037B06+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCTAG
JMFF006E17+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGC
JMFF049J13+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCTAGC
JMFF037P13+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCTAGC
JMFF038E01+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCTAGC
JMFF016I03+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCT
JMFF035N07+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCTAGC
JMFF031P05+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCTAGC
JMFF027E03+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCTAGC
JMFF020G01+ CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCTAGC
                      ____________________________________________________________
consensus CGCTTGGTGGTCGCAGAAAGGAGGAGACAACAGCGGAGGAGAGAAGAACGAGAAGCTAGC