Previous Contig 001021:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020E24Sequence556001021 (3)715009157 (7)
JMFF039F01Sequence558001021 (3)755009157 (7)
JMSF009G04Sequence403001021 (3)738022320

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF039F01+ CTGATCATTTACAATCCC
JMFF020E24+ GATCATTTACAATCCC
                      ____________________________________________________________
consensus CTGATCATTTACAATCCC
 
. : . : . : . : . : . :
JMFF039F01+ CATCCTCTTGATGCATAAACATATCAGAGATGGTACTGACAACAACATCACCACTTCTAA
JMFF020E24+ CATCCTCTTGATGCATAAACATATCAGAGATGGTACTGACAACAACATCACCACTTCTAA
                      ____________________________________________________________
consensus CATCCTCTTGATGCATAAACATATCAGAGATGGTACTGACAACAACATCACCACTTCTAA
 
. : . : . : . : . : . :
JMFF039F01+ AATCCCCAAGGCCAGTAGACTGTGACAGAACTGTTGTAGTAGTGACCACCAGGACTTGAC
JMSF009G04+ AGTAGACTGTGACAGAACTGTTGTAGTAGTGACCACCAGGACTTGAC
JMFF020E24+ AATCCCCAAGGCCAGTAGACTGTGACAGAACTGTTGTAGTAGTGACCACCAGGACTTGAC
                      ____________________________________________________________
consensus AATCCCCAAGGCCAGTAGACTGTGACAGAACTGTTGTAGTAGTGACCACCAGGACTTGAC
 
. : . : . : . : . : . :
JMFF039F01+ ATAGTACACCTTTTCTTCTTCAAAAATATTGCGATATTTCTTCACTTCTTCCTTTAAAAT
JMSF009G04+ ATAGTACACCTTTTCTTCTTCAAAAATATTGCGATATTTCTTCACTTCTTCCTTTAAAAT
JMFF020E24+ ATAGTACACCTTTTCTTCTTCAAAAATATTGCGATATTTCTTCACTTCTTCCTTTAAAAT
                      ____________________________________________________________
consensus ATAGTACACCTTTTCTTCTTCAAAAATATTGCGATATTTCTTCACTTCTTCCTTTAAAAT
 
. : . : . : . : . : . :
JMFF039F01+ ATTGACATGTATATAGGTTCCCCTATCTCACTGGATGACGAAGATAACTGCATCAATAGT
JMSF009G04+ ATTGACATGTATATAGGTTCCCCTATCTCACTGGATGACGAAGATAACTGCATCAATAGT
JMFF020E24+ ATTGACATGTATATAGGTTCCCCTATCTCACTGGATGACGAAGATAACTGCATCAATAGT
                      ____________________________________________________________
consensus ATTGACATGTATATAGGTTCCCCTATCTCACTGGATGACGAAGATAACTGCATCAATAGT
 
. : . : . : . : . : . :
JMFF039F01+ CATCTGGGTGGGGAGGAAGAATAGAACAGCTCACCAAGGTAATACTGAGAATCCTCTCTT
JMSF009G04+ CATCTGGGTGGGGAGGAAGAATAGAACAGCTCACCAAGGTAATACTGAGAATCCTCTCTT
JMFF020E24+ CATCTGGGTGGGGAGGAAGAATAGAACAGCTCACCAAGGTAATACTGAGAATCCTCTCTT
                      ____________________________________________________________
consensus CATCTGGGTGGGGAGGAAGAATAGAACAGCTCACCAAGGTAATACTGAGAATCCTCTCTT
 
. : . : . : . : . : . :
JMFF039F01+ GCTTTTTGATGCTTTTTTTACTCCAGAACCTGTCTACAACCTCAAATTTGATAAATTCAT
JMSF009G04+ GCTTTTTGATGCTTTTTTTACTCCAGAACCTGTCTACAACCTCAAATTTGATAAATTCAT
JMFF020E24+ GCTTTTTGATGCTTTTTTTACTCCAGAACCTGTCTACAACCTCAAATTTGATAAATTCAT
                      ____________________________________________________________
consensus GCTTTTTGATGCTTTTTTTACTCCAGAACCTGTCTACAACCTCAAATTTGATAAATTCAT
 
. : . : . : . : . : . :
JMFF039F01+ AGCTAACATTCTTGGTTGTAAGAGTGAGACTGTGAGAGAGATACCAGCGTTGATGTCCGG
JMSF009G04+ AGCTAACATTCTTGGTTGTAAGAGTGAGACTGTGAGAGAGATACCAGCGTTGATGTCCGG
JMFF020E24+ AGCTAACATTCTTGGTTGTAAGAGTGAGACTGTGAGAGAGATACCAGCGTTGATGTCCGG
                      ____________________________________________________________
consensus AGCTAACATTCTTGGTTGTAAGAGTGAGACTGTGAGAGAGATACCAGCGTTGATGTCCGG
 
. : . : . : . : . : . :
JMFF039F01+ AAACGAAGAAGATGGAGATGAACCCCTTACACACGGAGGACAACGGTCTATACCCACGCT
JMSF009G04+ AAACGAAGAAGATGGAGATGAACCCCTTACACACGGAGGACAACGGTCTATACCC
JMFF020E24+ AAACGAAGAAGATGGAGATGAACCCCTTACACACGGAGGACAACGGTCTATACCCACGCT
                      ____________________________________________________________
consensus AAACGAAGAAGATGGAGATGAACCCCTTACACACGGAGGACAACGGTCTATACCCACGCT
 
. : . : . : . : . : . :
JMFF039F01+ TGCTCATCTGTCCGTAGATGATAAGAGAGAGAGATCATTGAAGAACGACGAAAACAAAAT
JMFF020E24+ TGCTCATCTGTCCGTAGATGATAAGAGAGAGAGATCATTGAAGAACGACGAAAACGAAAT
                      ____________________________________________________________
consensus TGCTCATCTGTCCGTAGATGATAAGAGAGAGAGATCATTGAAGAACGACGAAAACGAAAT