Previous Contig 001015:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004O09Sequence461001015 (6)pir|T00514|T005142e-29cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara798020736pir|T09364|T093645e-50cytochrome P450 homolog F23K16.110 - Arabidopsis thaliana>gb:ATCHRIV91_1547932 A
JMFF019B17Sequence599001015 (6)pir|T00514|T005141e-41cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara737009618 (5)pir|T09364|T093641e-58cytochrome P450 homolog F23K16.110 - Arabidopsis thaliana>gb:ATCHRIV91_1547932 A
JMFF020D10Sequence481001015 (6)pir|T00514|T005143e-29cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara688009618 (5)pir|T09364|T093642e-49cytochrome P450 homolog F23K16.110 - Arabidopsis thaliana>gb:ATCHRIV91_1547932 A
JMFF029P24Sequence520001015 (6)pir|T00514|T005147e-33cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara667009618 (5)pir|T09364|T093643e-37cytochrome P450 homolog F23K16.110 - Arabidopsis thaliana>gb:ATCHRIV91_1547932 A
JMFF036G21Sequence387001015 (6)pir|T00514|T005142e-34cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFF046N06Sequence503001015 (6)pir|T00514|T005147e-32cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara467009618 (5)pir|G96611|G966117e-22probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF036G21+ ATG
                      ____________________________________________________________
consensus ATG
 
. : . : . : . : . : . :
JMFF036G21+ GTCCAAAACCAGCTTAGAGATTGAGTCGAACGTGAAACGTTGGAATATGTCTTGCAAATC
JMFF019B17+ TCTTGCAAATC
                      ____________________________________________________________
consensus GTCCAAAACCAGCTTAGAGATTGAGTCGAACGTGAAACGTTGGAATATGTCTTGCAAATC
 
. : . : . : . : . : . :
JMFF036G21+ AAACTCTACTCTCTGCTCTGCAAAACAATCAAGAACCGGCAACAACCCTTTCTCTACCTT
JMFF029P24+ GCAAAACAATCAAGAACCGGCAACAACCCTTTCTCTACCTT
JMFF046N06+ ACCGGCAACAACCCTTTCTCTACCTT
JMFF019B17+ AAACTCTACTCTCTGCTCTGCAAAACAATCAAGAACCGGCAACAACCCTTTCTCTACCTT
JMFF020D10+ T
                      ____________________________________________________________
consensus AAACTCTACTCTCTGCTCTGCAAAACAATCAAGAACCGGCAACAACCCTTTCTCTACCTT
 
. : . : . : . : . : . :
JMFF036G21+ GTGCCAAACATTGGTCTCTAACAAGGTGTGGAAGTGGGGATGATTGAAGAAGGAGAGGGT
JMFF029P24+ GTGCCAAACATTGGTCTCTAACAAGGTGTGGAAGTGGGGATGATTGAAGAAGGAGAGGGT
JMFF046N06+ GTGCCAAACATTGGTCTCTAACAAGGTGTGGAAGTGGGGATGATTGAAGAAGGAGAGGGT
JMFF004O09+ ACATTGGTCTCTAACAAGGTGTGGAAGTGGGGATGATTGAAGAAGGAGAGGGT
JMFF019B17+ GTGCCAAACATTGGTCTCTAACAAGGTGTGGAAGTGGGGATGATTGAAGAAGGAGAGGGT
JMFF020D10+ GTGCCAAACATTGGTCTCTAACAAGGTGTGGAAGTGGGGATGATTGAAGAAGGAGAGGGT
                      ____________________________________________________________
consensus GTGCCAAACATTGGTCTCTAACAAGGTGTGGAAGTGGGGATGATTGAAGAAGGAGAGGGT
 
. : . : . : . : . : . :
JMFF036G21+ GGTTTTACGGTGAAGCTCCCACAAAAAGGAATCGACGTTGAAAATGCCGTCTCCCAAAAC
JMFF029P24+ GGTTTTACGGTGAAGCTCCCACAAAAAGGAATAGACGTTGAAAATGCCGTCTCCCAAAAC
JMFF046N06+ GGTTNTACGGTGAAGCTCCCACAAAAAGGAATCGACGTTGAAAATGCCGTCTCCCAAAAC
JMFF004O09+ GGTTTTACGGTGAAGCTCCCACAAAAAGGAATCGACGTTGAAAATGCCGTCTCCCAAAAC
JMFF019B17+ GGTTTTACGGTGAAGCTCCCACAAAAAGGAATCGACGTTGAAAATGCCGTCTCCCAAAAC
JMFF020D10+ GGTTTTACGGTGAAGCTCCCACAAAAAGGAATCGACGTTGAAAATGCCGTCTCCCAAAAC
                      ____________________________________________________________
consensus GGTTTTACGGTGAAGCTCCCACAAAAAGGAATCGACGTTGAAAATGCCGTCTCCCAAAAC
 
. : . : . : . : . : . :
JMFF036G21+ ATCAAATATTTCTCGAAACTCAGGTCCTTTGGGATAGTTGGAGAAGTTTCGGCTGAGGAT
JMFF029P24+ ATCAAATATTTCTCGAAACTCAGGTCCTTTGGGATAGTTGGAGAAGTTTCGGCTGAGGAT
JMFF046N06+ ATCAAATATTTCTCGAAACTCAGGTCCTTTGGGATAGTTGGAGAAGTTTCGGCTGAGGAT
JMFF004O09+ ATCAAATATTTCTCGAAACTCAGGTCCTTTGGGATAGTTGGAGAAGTTTCGGCTGAGGAT
JMFF019B17+ ATCAAATATTTCTCGAAACTCAGGTCCTTTGGGATAGTTGGAGAAGTTTCGGCTGAGGAT
JMFF020D10+ ATCAAATATTTCTCGAAACTCAGGTCCTTTGGGATAGTTGGAGAAGTTTCGGCTGAGGAT
                      ____________________________________________________________
consensus ATCAAATATTTCTCGAAACTCAGGTCCTTTGGGATAGTTGGAGAAGTTTCGGCTGAGGAT
 
. : . : . : . : . : . :
JMFF036G21+ ATGGTGGATGTTAGCAGGGTCGCAGGTAATGAGCATGTCCAAGCTACCCGACACAAGTCC
JMFF029P24+ ATGGTGGATGTTAGCAGGGTCGCAGGTAATGAGCATGTCCAAGCTACCCGACACAAGTCC
JMFF046N06+ ATGGTGGATGTTAGCAGGGTCGCAGGTAATGAGCATGTCCAAGCTACCCGACACAAGTCC
JMFF004O09+ ATGGTGGATGTTAGCAGGGTCGCAGGTAATGAGCATGTCCAAGCTACCCGACACAAGTCC
JMFF019B17+ ATGGTGGATGTTAGCAGGGTCGCAGGTAATGAGCATGTCCAAGCTACCCGACACAAGTCC
JMFF020D10+ ATGGTGGATGTTAGCAGGGTCGCAGGTAATGAGCATGTCCAAGCTACCCGACACAAGTCC
                      ____________________________________________________________
consensus ATGGTGGATGTTAGCAGGGTCGCAGGTAATGAGCATGTCCAAGCTACCCGACACAAGTCC
 
. : . : . : . : . : . :
JMFF036G21+ TTTAAACTCAAATGTCCCTCCACT
JMFF029P24+ TTTAAACTCAAATGTCCCTCCACTCTCTTTCAAAAAATCATTGAAAAATTCATGAATCCG
JMFF046N06+ TTTAAACTCAAATGTCCCTCCACTCTCTTTCAAAAAATCATTGAAAAATTCATGAATCCG
JMFF004O09+ TTTAAACTCAAATGTCCCTCCACTCTCTTTCAAAAAATCATTGAAAAATTCATGAATCCG
JMFF019B17+ TTTAAACTCAAATGTCCCTCCACTCTCTTTCAAAAAATCATTGAAAAATTCATGAATCCG
JMFF020D10+ TTTAAACTCAAATGTCCCTCCACTCTCTTTCAAAAAATCATTGAAAAATTCATGAATCCG
                      ____________________________________________________________
consensus TTTAAACTCAAATGTCCCTCCACTCTCTTTCAAAAAATCATTGAAAAATTCATGAATCCG
 
. : . : . : . : . : . :
JMFF029P24+ GTAAGCATTGTGAATCAGCGCCGGCAACATTCCCACCACTGCCCACTTCCTTGGAATTCT
JMFF046N06+ GTAAGCATTGTGAATCAGCGCCGGCAACATTCCCACCACTGCCCACTTCCTTGGAATTCT
JMFF004O09+ GTAAGCATTGTGAATCAGCGCCGGCAACATTCCCACCACTGCCCACTTCCTTGGAATTCT
JMFF019B17+ GTAAGCATTGTGAATCAGCGCCGGCAACATTCCCACCACTGCCCACTTCCTTGGAATTCT
JMFF020D10+ GTAAGCATTGTGAATCAGCGCCGGCAACATTCCCACCACTGCCCACTTCCTTGGAATTCT
                      ____________________________________________________________
consensus GTAAGCATTGTGAATCAGCGCCGGCAACATTCCCACCACTGCCCACTTCCTTGGAATTCT
 
. : . : . : . : . : . :
JMFF029P24+ TTTCCTCCCACCTTTCATGCTCCGAATATAACAAAAACTAAATATCAGGAAGGCCACCAT
JMFF046N06+ TTTCCTCCCACCTTTCATGCTCCGAATATAACAAAAACTAAATATCAGGAAGGCCACCAT
JMFF004O09+ TTTCCTCCCACCTTTCATGCTCCGAATATAACAAAAACTAAATATCAGGAAGGCCACCAT
JMFF019B17+ TTTCCTCCCACCTTTCATGCTCCGAATATAACAAAAACTAAATATCAGGAAGGCCACCAT
JMFF020D10+ TTTCCTCCCACCTTTCATGCTCCGAATATAACAAAAACTAAATATCAGGAAGGCCACCAT
                      ____________________________________________________________
consensus TTTCCTCCCACCTTTCATGCTCCGAATATAACAAAAACTAAATATCAGGAAGGCCACCAT
 
. : . : . : . : . : . :
JMFF029P24+ CGCTACACCACACCTCCAATATTCTTTCATTTTGATTATATATGTATTGAGTT
JMFF046N06+ CGCTACACCACACCTCCAATATTCTTTCATTTTGATTATATATGTATTGAGTT
JMFF004O09+ CGCTACACCACACCTCCAATATTCTTTCATTTTGATTATATATATATT
JMFF019B17+ CGCTACACCACACCTCCAATATTCTTTCATTTTGATTATATATGTATTGAGTT
JMFF020D10+ CGCTACACCACACCTCCAATATTCTTTCATTTTGATTATATATGTATTGAGTTTTATACT
                      ____________________________________________________________
consensus CGCTACACCACACCTCCAATATTCTTTCATTTTGATTATATATGTATTGAGTTTTATACT