Previous Contig 001000:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019O15Sequence620001000 (3)gb:AC017118_15383216e-28Genomic sequence for Arabidopsis thaliana BAC F6N18 from chromosome I, complete 695009135 (2)pir|G86452|G864523e-21hypothetical protein F9L11.1 - Arabidopsis thaliana>gb:AE005172_892115 Arabidops
JMFS041G03Sequence546001000 (3)gb:OSJN00042_16937634e-19Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0045P24, complete seque
JMFS069B03Sequence642001000 (3)gb:AC017118_15383216e-36Genomic sequence for Arabidopsis thaliana BAC F6N18 from chromosome I, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS069B03+ TGAATGGATTATC
                      ____________________________________________________________
consensus TGAATGGATTATC
 
. : . : . : . : . : . :
JMFS069B03+ CATATTCAATGTCTTAGTTGGCAATTCCACCAGGAGCTGTGCAACTTCAGTTTCCTCACT
JMFF019O15+ GCAACTTCAGTTTCCTCACT
                      ____________________________________________________________
consensus CATATTCAATGTCTTAGTTGGCAATTCCACCAGGAGCTGTGCAACTTCAGTTTCCTCACT
 
. : . : . : . : . : . :
JMFS069B03+ ATCATTTCTACTGTTCTTATTCTTACACTTATCACAAGCAAACAGCTTCTCACTCTTGAC
JMFS041G03+ CACTCTTGAC
JMFF019O15+ ATCATTTCTACTGTTCTTATTCTTACACTTATCACAAGCAAACAGCTTCTCACTCTTGAC
                      ____________________________________________________________
consensus ATCATTTCTACTGTTCTTATTCTTACACTTATCACAAGCAAACAGCTTCTCACTCTTGAC
 
. : . : . : . : . : . :
JMFS069B03+ ATATCCCACACACCGCGTATGCACCCACACACCACAGTCATCACAATTCACCATCTCCTC
JMFS041G03+ ATATCCCACACACCGCGTATGCACCCACACACCACAGTCATCACAATTCACCATCTCCTC
JMFF019O15+ ATATCCCACACACCGCGTATGCACCCACACACCACAGTCATCACAATTCACCATCTCCTC
                      ____________________________________________________________
consensus ATATCCCACACACCGCGTATGCACCCACACACCACAGTCATCACAATTCACCATCTCCTC
 
. : . : . : . : . : . :
JMFS069B03+ TCCATCGTCAAAATTCACCCCGCACACACAGTCCACAGTCCATGAACCATCCCCCCAGTC
JMFS041G03+ TCCATCGTCAAAATTCACTCCGCACACACAGTCCACAGTCCATGAACCATCCCCCCAGTC
JMFF019O15+ TCCATCGTCAAAATTCACCCCGCACACACAGTCCACAGTCCATGAACCATCCCCCCAGTC
                      ____________________________________________________________
consensus TCCATCGTCAAAATTCACCCCGCACACACAGTCCACAGTCCATGAACCATCCCCCCAGTC
 
. : . : . : . : . : . :
JMFS069B03+ ATCCTGCGGATTTGGCATCGGCAGTCCATTCGATCGACTCTTCATTCTTCTACCTCCCTC
JMFS041G03+ ATCCTGCGGATTTGGCATCGGCAGTCCATTCGATCGACTCTTCATTCTTCTACCTCCCTC
JMFF019O15+ ATCCTGCGGATTTGGCATCGGCAGTCCATTCGATCGACTCTTCATTCTTCTACCTCCCTC
                      ____________________________________________________________
consensus ATCCTGCGGATTTGGCATCGGCAGTCCATTCGATCGACTCTTCATTCTTCTACCTCCCTC
 
. : . : . : . : . : . :
JMFS069B03+ TCTCTATCTCTCTCTAACCCTAATCAAAACAAAATCCTAAACTGACCACGATTCTCCACG
JMFS041G03+ TCTCTATCTCTCTCTAACCGTAATCAAAACAAAATCCTAAACTGACCACGATTCTCCACG
JMFF019O15+ TCTCTATCTCTCTCTAACCCTAATCAAAACAAAATCCTAAACTGACCACGATTCTCCACG
                      ____________________________________________________________
consensus TCTCTATCTCTCTCTAACCCTAATCAAAACAAAATCCTAAACTGACCACGATTCTCCACG
 
. : . : . : . : . : . :
JMFS069B03+ AATTGCTTAACCACAAGCTAACAATCCCTCCACTCTCACACGTCGGCATCATTTAACAGA
JMFS041G03+ AATTGTTTAACCACAAGCTAACAATCCCTCCACTCTCACACGTCGGCATCATTTAACAGA
JMFF019O15+ AATTGCTTAACCACAAGCTAACAATCCCTCCACTCTCACACGTCGGCATCATTTAACAGA
                      ____________________________________________________________
consensus AATTGCTTAACCACAAGCTAACAATCCCTCCACTCTCACACGTCGGCATCATTTAACAGA
 
. : . : . : . : . : . :
JMFS069B03+ TTACAAAAAGAGCAACATAAAGCCATAGCTATGAAATTCTTCAATATTAAACTCACAAAA
JMFS041G03+ TTACAAAAAGAGCAACATAAAGCCATAGCTATGAAATTCTTCAATATTAAACTCACAAAA
JMFF019O15+ TTACAAAAAGAGCAACATAAAGCCATAGCTATGAAATTCTTCAATATTAAACTCACAAAA
                      ____________________________________________________________
consensus TTACAAAAAGAGCAACATAAAGCCATAGCTATGAAATTCTTCAATATTAAACTCACAAAA
 
. : . : . : . : . : . :
JMFS069B03+ CAAGGAGTGTCGAGAATACAGTTTAAGGATGTGTACCGAAAGGCGAAATCTCGTCCCCGG
JMFS041G03+ CAAGGAGTGTCGAGAATACAGTTTAAGGATGTGTACCGAAAGGCGAAATCTCGTCCCCGG
JMFF019O15+ CAAGGAGTGTCGAGAATACAGTTTAAGGATGTGTACCGAAAGGCGAAATCTCGTCCCCGG
                      ____________________________________________________________
consensus CAAGGAGTGTCGAGAATACAGTTTAAGGATGTGTACCGAAAGGCGAAATCTCGTCCCCGG
 
. : . : . : . : . : . :
JMFS069B03+ TCCCCGTGGCCCGTCGATGCTACGGCGAGGAAGCAAAATAAGACGGTGTGATAGAAGCGG
JMFS041G03+ TCCCCGTGGCCCGTCGATGCTACGGCGAGGAAGCAAAATAAGACGGTGTGATAGAAGCGG
JMFF019O15+ TCCCCGTGGCCCGTCGATGCTACGGCGAGGAAGCAAAATAAGACGGTGTGATAGAAGCGG
                      ____________________________________________________________
consensus TCCCCGTGGCCCGTCGATGCTACGGCGAGGAAGCAAAATAAGACGGTGTGATAGAAGCGG
 
. : . : . : . : . : . :
JMFS069B03+ CTTGAAGGTCAGAATTCCGGCAGTGAGAA
JMFS041G03+ CTTGAAGGTCAGAATTCCGGCAGTGAGAAAGGCTAGGCGGCAAGCCAAGTTTG
JMFF019O15+ CTTGAAGGTCAGAATTCCGGCAGTGAGAAAGGCTAGGCGGGAAGCCAAGTTTGTGACACT
                      ____________________________________________________________
consensus CTTGAAGGTCAGAATTCCGGCAGTGAGAAAGGCTAGGCGGGAAGCCAAGTTTGTGACACT