Previous Contig 000996:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H04Sequence500000996 (15)gb:AB005233_15093225e-43Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580750011093 (16)gb:AB005233_15093224e-81Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMFF008M16Sequence573000996 (15)gb:AB005233_15093221e-73Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580747011093 (16)gb:AB005233_15093228e-81Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMFF019N08Sequence570000996 (15)gb:AB005233_15093222e-52Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580800011093 (16)gb:AB005233_15093224e-88Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMFF030J08Sequence491000996 (15)gb:AB005233_15093228e-59Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580749011093 (16)gb:AB005233_15093228e-76Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMFF051I23Sequence586000996 (15)gb:AB005233_15093221e-58Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580599011093 (16)gb:AB005233_15093226e-53Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMSF002E06Sequence431000996 (15)gb:AB005233_15093222e-31Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580745011093 (16)gb:AB005233_15093226e-84Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMSF003B07Sequence246000996 (15)803011093 (16)gb:AB005233_15093228e-85Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMSF003E06Sequence473000996 (15)gb:AB005233_15093221e-38Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580742011093 (16)gb:AB005233_15093222e-83Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMSF013H16Sequence528000996 (15)gb:AB005233_15093224e-52Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580778011093 (16)gb:AB005233_15093221e-88Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMSF017A15Sequence339000996 (15)gb:AF037037_17631223e-16Zea mays 6-phosphogluconate dehydrogenase isoenzyme A gene, partial cds.723011093 (16)gb:AB005233_15093224e-91Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMSF019F20Sequence223000996 (15)gb:AB005233_15093226e-30Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580777011093 (16)gb:AB005233_15093221e-87Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMSF030P17Sequence632000996 (15)gb:AB005233_15093221e-66Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580712011093 (16)gb:AB005233_15093221e-80Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMSF032N23Sequence680000996 (15)gb:AB005233_15093229e-92Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580693011093 (16)gb:AB005233_15093228e-77Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMSF038A15Sequence688000996 (15)gb:AB005233_15093226e-72Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580930011093 (16)gb:AB005233_1509322e-112Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580
JMSF049L10Sequence631000996 (15)gb:AB005233_15093229e-66Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580776011093 (16)gb:AB005233_15093221e-88Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23.>gb:AY125503_1580

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032N23+ CGTACTCGATCCCATTG
                      ____________________________________________________________
consensus CGTACTCGATCCCATTG
 
. : . : . : . : . : . :
JMSF032N23+ TGGACCATTTTGACGAAATTACCCGACCCGCCCTCGCCGATGTAGGTGACGCAGGGGCCG
                      ____________________________________________________________
consensus TGGACCATTTTGACGAAATTACCCGACCCGCCCTCGCCGATGTAGGTGACGCAGGGGCCG
 
. : . : . : . : . : . :
JMFF008M16+ TTGTTGAGGATGTCCTGGACGTTGAGGTAGGCCTGGTGG
JMSF032N23+ TCCTCCACCTGGGCGGCGACCTTGTTGAGGATGCCCTGGACGTTGAGGTAGGCCTGGTGG
JMSF038A15+ TTGTTGAGGATGTCCTGGACGTTGAGGTAGGCCTGGTGG
                      ____________________________________________________________
consensus TCCTCCACCTGGGCGGCGACCTTGTTGAGGATGTCCTGGACGTTGAGGTAGGCCTGGTGG
 
. : . : . : . : . : . :
JMFF008M16+ GACCCCCCGGGCATGAGGGAAGGGCCGTACCGAGCTCCATCCTCGCCGCCGGAAACGCCC
JMSF032N23+ GACCCCCCGGGCATGAGGGAAGGGCCGTACCGAGCTCCATCCTCGCCGCCGGAAACGCCC
JMSF038A15+ GACCCCCCGGGCATGAGGGAAGGGCCGTACCGAGCTCCATCCTCGCCGCCGGAAACGCCC
JMFF030J08+ GAAACGCCC
JMSF030P17+ CGGGCATGAGGGAAGGGCCGTACCGAGCTCCATCCTCGCCGCCGGAAACGCCC
JMFF051I23+ AACGCCC
JMSF049L10+ GGCATGAGGGAAGGGCCGTACCGAGCTCCATCCTCGCCGCCGGAAACGCCC
                      ____________________________________________________________
consensus GACCCCCCGGGCATGAGGGAAGGGCCGTACCGAGCTCCATCCTCGCCGCCGGAAACGCCC
 
. : . : . : . : . : . :
JMSF019F20+ CCTCGGAGATGCGGCGCTCGGTGTTCTCG
JMFF008M16+ ATGCCGAGATACAGCAAACCCTTGGCGGAGGCCTCGGAGATGCGGCGCTCGGTGTTCTCG
JMSF032N23+ ATGCCGAGATACAGCAAACCCTTGGCGGAGGCCTCGGAGATGCGGCGCTCGGTGTTCTCG
JMSF038A15+ ATGCCGAGATACAGCAAACCCTTGGCGGAGGCCTCGGAGATGTGGCGCTCGGTGTTCTCG
JMFF030J08+ ATGCCGAGATACAGCAAACCCTTGGCGGAGGCCTCGGAGATGCGGCGCTCGGTGTTCTCG
JMSF030P17+ ATGCCGAGATACAGCAAACCCTTGGCGGAGGCCTCGGAGATGCGGCGCTCGGTGTTCTCG
JMSF013H16+ GAGATGCGGCGCTCGGTGTTCTCG
JMFF051I23+ ATGCCGAGATACAGCAAACCCTTGGCGGAGGCCTCGGAGATGCGGCGCTCGGTGTTCTCG
JMSF049L10+ ATGCCGAGATACAGCAAACCCTTGGCGGAGGCCTCGGAGATGCGGCGCTCGGTGTTCTCG
JMFF019N08+ GCCTCGGAGATGCGGCGCTCGGTGTTCTCG
                      ____________________________________________________________
consensus ATGCCGAGATACAGCAAACCCTTGGCGGAGGCCTCGGAGATGCGGCGCTCGGTGTTCTCG
 
. : . : . : . : . : . :
JMSF019F20+ TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
JMFF008M16+ TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
JMSF032N23+ TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
JMSF038A15+ TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
JMFF030J08+ TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
JMSF030P17+ TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
JMSF013H16+ TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
JMFF051I23+ TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
JMFF002H04+ CGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
JMSF049L10+ TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
JMSF003E06+ CTCCGATAAGGCG
JMFF019N08+ TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
                      ____________________________________________________________
consensus TACCACTCGTTGCCGCCGTCGATGATGGTGTCGCCGGGCTCCATGTGCTCCGATAAGGCG
 
. : . : . : . : . : . :
JMSF019F20+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMFF008M16+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMSF032N23+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMSF038A15+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMFF030J08+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMSF030P17+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMSF013H16+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMFF051I23+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMFF002H04+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMSF049L10+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMSF003E06+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
JMSF002E06+ CTTGACGAGGATGATAACAGATCTCGGGCGC
JMFF019N08+ GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
                      ____________________________________________________________
consensus GCGATGGTTTGGTCAACGGGAGCCCCCGCCTTGACGAGGATGATAACAGATCTCGGGCGC
 
. : . : . : . : . : . :
JMSF019F20+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMFF008M16+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMSF032N23+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMSF038A15+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMFF030J08+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMSF030P17+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMSF013H16+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMFF051I23+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMFF002H04+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMSF049L10+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMSF003E06+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMSF002E06+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
JMFF019N08+ TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCC
                      ____________________________________________________________
consensus TGAATTGACAGGACGAAATCGCGGGGATTGTACTGCCCAACTAAAGGAAGCTGGCCCTCT
 
. : . : . : . : . : . :
JMSF019F20+ CTCTGAGCCCGCTC
JMFF008M16+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMSF032N23+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMSF038A15+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMFF030J08+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMSF030P17+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMSF013H16+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMFF051I23+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMSF017A15+ TGAGCCCGCTCCACNGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMFF002H04+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMSF049L10+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMSF003E06+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMSF002E06+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
JMFF019N08+ CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
                      ____________________________________________________________
consensus CTCTGAGCCCGCTCCACCGTCTCGTCCACCTTGGAAGTCGTCCTGTTGTACACCGAAATT
 
. : . : . : . : . : . :
JMFF008M16+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMSF032N23+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMSF038A15+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMFF030J08+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMSF030P17+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMSF013H16+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMFF051I23+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMSF017A15+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMSF003B07+ TTCTGACCCATCACGGCCAGACCCGCG
JMFF002H04+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMSF049L10+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMSF003E06+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMSF002E06+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
JMFF019N08+ GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
                      ____________________________________________________________
consensus GGGAAGCCTTTCTCGGCGACGTTCAAGGCCAAGTTCTGACCCATCACGGCCAGACCCGCG
 
. : . : . : . : . : . :
JMFF008M16+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMSF032N23+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMSF038A15+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMFF030J08+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMSF030P17+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMSF013H16+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMFF051I23+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMSF017A15+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMSF003B07+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMFF002H04+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMSF049L10+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMSF003E06+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMSF002E06+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
JMFF019N08+ AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
                      ____________________________________________________________
consensus AGTCCTATCCGGGACAGAGCTTGAGCGGCAGCGACTTCCATGGCAACAAAACGATGATAC
 
. : . : . : . : . : . :
JMFF008M16+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAAT
JMSF032N23+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMSF038A15+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMFF030J08+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMSF030P17+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMSF013H16+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMFF051I23+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMSF017A15+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMSF003B07+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMFF002H04+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMSF049L10+ TGAAGAATCGGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMSF003E06+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMSF002E06+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
JMFF019N08+ TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
                      ____________________________________________________________
consensus TGAAGAATCAGAAAATCAAGATTGAAGGAGAAAGGTTTTCAGTAATGGAGTGCAAGTATA
 
. : . : . : . : . : . :
JMSF038A15+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
JMFF030J08+ TC
JMSF030P17+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
JMSF013H16+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
JMFF051I23+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
JMSF017A15+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
JMSF003B07+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
JMFF002H04+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
JMSF049L10+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
JMSF003E06+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
JMSF002E06+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
JMFF019N08+ TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
                      ____________________________________________________________
consensus TCGGAGAAGGTTAGGTAGGTAAAGGCTTTTTAGTAATAGTGACGGACTCGTCGAGGGCGT
 
. : . : . : . : . : . :
JMSF038A15+ GAAGAGGCAGCCACCAACCAAACAACCCTCTTCTCCCTC
JMSF030P17+ GAAGAGGCAGCCACCAACCAAACAACCCTCTTCCCCCTC
JMSF013H16+ GAAGAGGCAGCCACCAACCAAAC
JMFF051I23+ GAAGAGGCAGCCACCAACCAAACAACCCTCTTCTCCCTC
JMSF017A15+ GAAGAGGCAGCCACCAACCAAACAACCCTCTTCTCCC
JMSF003B07+ GAAGAGGCAGCCACCAACCAAACAACCCTCTTCTCCCTC
JMFF002H04+ GAAGAGGCAGCCACCAACCAAACAACCCTCTTCTCCCTC
JMSF049L10+ GAAGAGGCAGCCACCAACCAAACAACCCTCTTCTCCCTC
JMSF003E06+ GAAGAGGCAGCCACCAACCAAACAACCCTCTTCTCCCTC
JMSF002E06+ GAAGAGGCAGCCACCAACCAAACAACCCTCTTCTCCCTC
JMFF019N08+ GAAGAGGCAGCCACCAACCAAACAACCCTCTTCTCCCTAGGTTGTCGCTTCAGCTTAGGC
                      ____________________________________________________________
consensus GAAGAGGCAGCCACCAACCAAACAACCCTCTTCTCCCTCGGTTGTCGCTTCAGCTTAGGC