Previous Contig 000992:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019L20Sequence535000992 (3)706011690 (2)
JMSF012H08Sequence226000992 (3)731011690 (2)
JMSF022B17Sequence689000992 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022B17+ TACGCAACCCTAACACCAAAGACAATTCTT
                      ____________________________________________________________
consensus TACGCAACCCTAACACCAAAGACAATTCTT
 
. : . : . : . : . : . :
JMSF022B17+ CATTGACAAACATAAACATCAAAGACGAAGCCAATAACAACACGTCGTGGAATATGTAGC
                      ____________________________________________________________
consensus CATTGACAAACATAAACATCAAAGACGAAGCCAATAACAACACGTCGTGGAATATGTAGC
 
. : . : . : . : . : . :
JMSF022B17+ AATCAATTTCTGCGGAATTCCAATCAAATTTAAATTAAATAGCAGCTTCAATCGCTTCGC
                      ____________________________________________________________
consensus AATCAATTTCTGCGGAATTCCAATCAAATTTAAATTAAATAGCAGCTTCAATCGCTTCGC
 
. : . : . : . : . : . :
JMSF022B17+ CCAGTGGAGAAACCCTAAAGAATAGGTATCCCCAGCAAAATTTGCCTCATGTTCCAATCT
                      ____________________________________________________________
consensus CCAGTGGAGAAACCCTAAAGAATAGGTATCCCCAGCAAAATTTGCCTCATGTTCCAATCT
 
. : . : . : . : . : . :
JMSF022B17+ CAACATAAAGCCACATAAATTTCAGGGCATCCCAGCGTTACGTCTTCATATATGGCGCAA
                      ____________________________________________________________
consensus CAACATAAAGCCACATAAATTTCAGGGCATCCCAGCGTTACGTCTTCATATATGGCGCAA
 
. : . : . : . : . : . :
JMSF022B17+ TTGGTAGTACCCCAGGCCGAGATGATGTAAACAATTCTCTTGGCAATCCATACACACAAA
                      ____________________________________________________________
consensus TTGGTAGTACCCCAGGCCGAGATGATGTAAACAATTCTCTTGGCAATCCATACACACAAA
 
. : . : . : . : . : . :
JMSF022B17+ GCGGTTCTCCTCTTTGATTAGAGAAAAACCAAGAAAAAGCGTACTAAATCATAAACTAGG
                      ____________________________________________________________
consensus GCGGTTCTCCTCTTTGATTAGAGAAAAACCAAGAAAAAGCGTACTAAATCATAAACTAGG
 
. : . : . : . : . : . :
JMSF022B17+ GTTTTCAATACCTGTTCTTCTCGTGGACCCCTAAAAACTCGCCACCAATCAGCGATTGGA
JMFF019L20+ ACCTGTTCTTCTCGTGGACCCCTAAAAACTCGCCACCAATCAGCGATTGGA
                      ____________________________________________________________
consensus GTTTTCAATACCTGTTCTTCTCGTGGACCCCTAAAAACTCGCCACCAATCAGCGATTGGA
 
. : . : . : . : . : . :
JMSF022B17+ CGATTTATCCCCAGAACTCAGCGATTACACGGTCTATCGTCAATACTTGTAAATCTCTCA
JMSF012H08+ GAACTCAGCGATTACACGGTCTATCGTCAATACTTGTAAATCTCTCA
JMFF019L20+ CGATTTATCCCCAGAACTCAGCGATTACACGGTCTATCGTCAATACTTGTAAATCTCTCA
                      ____________________________________________________________
consensus CGATTTATCCCCAGAACTCAGCGATTACACGGTCTATCGTCAATACTTGTAAATCTCTCA
 
. : . : . : . : . : . :
JMSF022B17+ AAATTCTTCGAACGAGGAATACTGTATCCTCTATATACAATTATATCCGTAAGCTCTGAT
JMSF012H08+ AAATTCTTCGAACGAGGAATACTGTATCCTCTATATACAATTATATCCGTAAGCTCTGAT
JMFF019L20+ AAATTCTTCGAACGAGGAATACTGTATCCTCTATATACAATTATATCCGTAAGCTCTGAT
                      ____________________________________________________________
consensus AAATTCTTCGAACGAGGAATACTGTATCCTCTATATACAATTATATCCGTAAGCTCTGAT
 
. : . : . : . : . : . :
JMSF022B17+ GAATTCTCAGTAATCTCGACTGCGTAGTAGTCAACTCTGTCGGTCGTCGAATTCCCGCCG
JMSF012H08+ GAATTCTCAGTAATCTCGACTGCGTAGTAGTCAACTCTGTCGGTCGTCGAATTCCCGCCG
JMFF019L20+ GAATTCTCAGTAATCTCGACTGCGTAGTAGTCAACTCTGTCGGTCGTCGAATTCCCGCCG
                      ____________________________________________________________
consensus GAATTCTCAGTAATCTCGACTGCGTAGTAGTCAACTCTGTCGGTCGTCGAATTCCCGCCG
 
. : . : . : . : . : . :
JMSF022B17+ GCGAAGATGATATGGAATCTCGATCCTTCCTGTCTTCTAATCTCTTCCAGCGAAT
JMSF012H08+ GCGAAGATGATATGGAATCTCGATCCTTCCTGTCTTCTAATCTCTTCCAGCGAAT
JMFF019L20+ GCGAAGATGATATGGAATCTCGATCCTTCCTGTCTTCTAATCTCTTCCAGCGAATAACCC
                      ____________________________________________________________
consensus GCGAAGATGATATGGAATCTCGATCCTTCCTGTCTTCTAATCTCTTCCAGCGAATAACCC