Previous Contig 000988:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H13Sequence472000988 (10)gb:BT014978_16419484e-56Arabidopsis thaliana At4g19420 gene, complete cds.>gb:BT015714_1642332 Arabidops695005979 (12)pir|S68805|S688055e-52pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF003D13Sequence537000988 (10)gb:BT014978_16419488e-51Arabidopsis thaliana At4g19420 gene, complete cds.>gb:BT015714_1642332 Arabidops759005979 (12)pir|S68805|S688052e-67pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF010G02Sequence593000988 (10)gb:BT014978_16419483e-58Arabidopsis thaliana At4g19420 gene, complete cds.>gb:BT015714_1642332 Arabidops763005979 (12)pir|S68805|S688051e-67pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF017L13Sequence580000988 (10)gb:BT014978_16419488e-55Arabidopsis thaliana At4g19420 gene, complete cds.>gb:BT015714_1642332 Arabidops756005979 (12)pir|S68805|S688057e-33pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF019K04Sequence517000988 (10)800005979 (12)pir|S68805|S688052e-73pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF023O10Sequence459000988 (10)gb:AP004052_18369562e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12719005979 (12)pir|S68805|S688059e-55pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF041O12Sequence617000988 (10)pir|S68805|S688052e-64pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r620005979 (12)pir|S68805|S688055e-40pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFS108B04Sequence623000988 (10)pir|S68805|S688052e-64pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMSF023A01Sequence628000988 (10)pir|S68805|S688053e-63pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r702005979 (12)pir|S68805|S688052e-67pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMSF044J19Sequence135000988 (10)684005979 (12)pir|S68805|S688052e-51pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF001H13+ GGCTAATAAGTCTTCT
JMFF041O12+ AAGCATTTTTGCA-TTCTTCATTCCTTTGGCTAATAAGTCTTCT
JMFS108B04+ AGCATTTTTGCATTTCTTCATTCCTTTGGCTAATAAGTCTTCT
JMSF023A01+ TCTTCATTCCTTTGGCTAATAAGTCTTCT
                      ____________________________________________________________
consensus AAGCATTTTTGCATTTCTTCATTCCTTTGGCTAATAAGTCTTCT
 
. : . : . : . : . : . :
JMFF001H13+ ATAACAGCGACAAACACTCTTGCACCTCTGAAGTGAAGATTGGTTTTCGGGTTTACTGCC
JMFF041O12+ ATAACAGCGACAAACACTCTTGCACCTCTGAAGTGAAGATTGGTTTTCGGGTTTACTGCC
JMFS108B04+ ATAACAGCGACAAACACTCTTGCACCTCTGAAGTGAAGATTGGTTTTCGGGTTTACTGCC
JMFF003D13+ GGTTTACTGCC
JMFF017L13+ TGAAGTGAAGATTGGTTTTCGGGTTTACTGCC
JMFF010G02+ AGCGACAAACACTCTTGCACCTCTGAAGTGAAGATTGGTTTTCGGGTTTACTGCC
JMSF023A01+ ATAACAGCGACAAACACTCTTGCACCTCTGAAGTGAAGATTGGTTTTCGGGTTTACTGCC
                      ____________________________________________________________
consensus ATAACAGCGACAAACACTCTTGCACCTCTGAAGTGAAGATTGGTTTTCGGGTTTACTGCC
 
. : . : . : . : . : . :
JMFF001H13+ TCAACATCGCCAGTAAACGATGATCCATCACAATACCTAACCTTGATTCGGTTCCAGGTG
JMFF041O12+ TCAACATCGCCAGTAAACGATGATCCATCACAATACCTAACCTTGATTCGGTTCCAGGTG
JMFS108B04+ TCAACATCGCCAGTAAACGATGATCCATCACAATACCTAACCTTGATTCGGTTCCAGGTG
JMFF003D13+ TCAACATCGCCAGTAAACGATGATCCATCACAATACCTAACCTTGATTCGGTTCCAGGTG
JMFF017L13+ TCAACATCGCCAGTAAACGATGATCCATCACAATACCTAACCTTGATTCGGTTCCAGGTG
JMFF010G02+ TCAACATCGCCAGTAAACGATGATCCATCACAATACCTAACCTTGATTCGGTTCCAGGTG
JMSF023A01+ TCAACATCGCCAGTAAACGATGATCCATCACAATACCTAACCTTGATTCGGTTCCAGGTG
                      ____________________________________________________________
consensus TCAACATCGCCAGTAAACGATGATCCATCACAATACCTAACCTTGATTCGGTTCCAGGTG
 
. : . : . : . : . : . :
JMFF001H13+ TAGAAGTCCGGATTTCT-ATGGGATGGTTACCCAGGAGCCCTGAAAAAGCAACCTGCTTT
JMFF041O12+ TAGAAGTCCGGATTTCTCTTGGGATGGTTACCCAGGAGCCCTGAAAAAGCAACCTGCTTT
JMFS108B04+ TAGAAGTCCGGATTTCTCTTGGGATGGTTACCCAGGAGCCCTGAAAAAGCAACCTGCTTT
JMFF003D13+ TAGAAGTCCGGATTTCTCTTGGGATGGTTACCCAGGAGCCCTGAAAAAGCAACCTGCTTT
JMFF017L13+ TAGAAGTCCGGATTTCTCTTGGGATGGTTACCCAGGAGCCCTGAAAAAGCAACCTGCTTT
JMFF023O10+ TGGGATGGTTACCCAGGAGCCCTGAAAAAGCAACCTGCTTT
JMFF010G02+ TAGAAGTCCGGATTTCTCTTGGGATGGTTACCCAGGAGCCCTGAAAAAGCAACCTGCTTT
JMSF023A01+ TAGAAGTCCGGATTTCTCTTGGGATGGTTACCCAGGAGCCCTGAAAAAGCAACCTGCTTT
                      ____________________________________________________________
consensus TAGAAGTCCGGATTTCTCTTGGGATGGTTACCCAGGAGCCCTGAAAAAGCAACCTGCTTT
 
. : . : . : . : . : . :
JMFF001H13+ ACCATTTTCGTTGAAGACCCCAACCGAGTATCCTTACGAGCAAGGCAAGTAGTGACATTA
JMFF041O12+ ACCATTTTCGTTGAAGACCCCAACCGAGTATCCTTACGAGCAAGGCAAGTAGTGACATTA
JMFS108B04+ ACCATTTTCGTTGAAGACCCCAACCGAGTATCCTTACGAGCAAGGCAAGTAGTGACATTA
JMFF003D13+ ACCATTTTCGTTGAAGACCCCAACCGAGTATCCTTACGAGCAAGGCAAGTAGTGACATTA
JMFF017L13+ ACCATTTTCGTTGAAGACCCCAACCGAGTATCCTTACGAGCAAGGCAAGTAGTGACATTA
JMFF023O10+ ACCATTTTCGTTGAAGACCCCAACCGAGTATCCTTACGAGCAAGGCAAGTAGTGACATTA
JMFF010G02+ ACCATTTTCGTTGAAGACCCCAACCGAGTATCCTTACGAGCAAGGCAAGTAGTGACATTA
JMSF023A01+ ACCATTTTCGTTGAAGACCCCAACCGAGTATCCTTACGAGCAAGGCAAGTAGTGACATTA
                      ____________________________________________________________
consensus ACCATTTTCGTTGAAGACCCCAACCGAGTATCCTTACGAGCAAGGCAAGTAGTGACATTA
 
. : . : . : . : . : . :
JMFF001H13+ TTGCACCACGCTCCTCCCTCAAAATGGATTAACCAATTGTTAATTCCTTCTCCAGATCCT
JMFF041O12+ TTGCACCACGCTCCTCCCTCAAAATGGATTAACCAATTGTTAATTCCTTCTCCAGATCCT
JMFS108B04+ TTGCACCACGCTCCTCCCTCAAAATGGATTAACCAATTGTTAATTCCTTCTCCAGATCCT
JMFF003D13+ TTGCACCACGCTCCTCCCTCAAAATGGATTAACCAATTGTTAATTCCTTCTCCAGATCCT
JMFF017L13+ TTGCACCACGCTCCTCCCTCAAAATGGATTAACCAATTGTTAATTCCTTCTCCAGATCCT
JMFF023O10+ TTGCACCACGCTCCTCCCTCAAAATGGATTAACCAATTGTTAATTCCTTCTCCAGATCCT
JMFF010G02+ TTGCACCACGCTCCTCCCTCAAAATGGATTAACCAATTGTTAATTCCTTCTCCAGATCCT
JMSF023A01+ TTGCACCACGCTCCTCCCTCAAAATGGATTAACCAATTGTTAATTCCTTCTCCAGATCCT
                      ____________________________________________________________
consensus TTGCACCACGCTCCTCCCTCAAAATGGATTAACCAATTGTTAATTCCTTCTCCAGATCCT
 
. : . : . : . : . : . :
JMFF001H13+ CTGTCAAAATGGTAGGCTGGTGGACTTCCATCCAGACATACTGCTCCTTTTGCCACAGCA
JMFF041O12+ CTGTCAAAATGGTAGGCTGGTGGACTTCCATCCAGACATACTGCTCCTTTTGCCACAGCA
JMFS108B04+ CTGTCAAAATGGTAGGCTGGTGGACTTCCATCCAGACATACTGCTCCTTTTGCCACAGCA
JMFF003D13+ CTGTCAAAATGGTAGGCTGGTGGACTTCCATCCAGACATACTGCTCCTTTTGCCACAGCA
JMFF017L13+ CTGTCAAAATGGTAGGCTGGTGGACTTCCATCCAGACATACTGCTCCTTTTGCCACAGCA
JMFF023O10+ CTGTCAAAATGGTAGGCTGGTGGACTTCCATCCAGACATACTGCTCCTTTTGCCACAGCA
JMFF010G02+ CTGTCAAAATGGTAGGCTGGTGGACTTCCATCCAGACATACTGCTCCTTTTGCCACAGCA
JMSF023A01+ CTGTCAAAATGGTAGGCTGGTGGACTTCCATCCAGACATACTGCTCCTTTTGCCACAGCA
                      ____________________________________________________________
consensus CTGTCAAAATGGTAGGCTGGTGGACTTCCATCCAGACATACTGCTCCTTTTGCCACAGCA
 
. : . : . : . : . : . :
JMFF001H13+ CTCTGAACATAAGTGATATCGACAAAGAAGCCTTCTGTTCTCAAAAGAATCATGAAAAAC
JMFF041O12+ CTCTGAACATAAGTGATATCGACAAAGAAGCCTTCTGTTCTCAAAAGAATCATGAAAAAC
JMFS108B04+ CTCTGAACATAAGTGATATCGACAAAGAAGCCTTCTGTTCTCAAAAGAATCATGAAAAAC
JMFF003D13+ CTCTGAACATAAGTGATATCGACAAAGAAGCCTTCTGTTCTCAAAAGAATCATGAAAAAC
JMFF017L13+ CTCTGAACATAAGTGATATCGACAAAGAAGCCTTCTGTTCTCAAAAGAATCATGAAAAAC
JMFF023O10+ CTCTGAACATAAGTGATATCGACAAAGAAGCCTTCTGTTCTCAAAAGAATCATGAAAAAC
JMFF010G02+ CTCTGAACATAAGTGATATCGACAAAGAAGCCTTCTGTTCTCAAAAGAATCATGAAAAAC
JMSF023A01+ CTCTGAACATAAGTGATATCGACAAAGAAGCCTTCTGTTCTCAAAAGAATCATGAAAAAC
                      ____________________________________________________________
consensus CTCTGAACATAAGTGATATCGACAAAGAAGCCTTCTGTTCTCAAAAGAATCATGAAAAAC
 
. : . : . : . : . : . :
JMFF001H13+ GCCAACCCATACACCACCCATTTTTGCACTCCCAAAT
JMFF041O12+ GCCAACCCATACACCACCCATTTTTGCACTCCCAAATTCTCCATA----------CTGTA
JMFS108B04+ GCCAACCCATACACCACCCATTTTTGCACTCCCAAATTCTCCATA----------CTGTA
JMFF003D13+ GCCAACCCATACACCACCCATTTTTGCACTCCCAAATTCTCCATA----------CTGTA
JMFF017L13+ GCCAACCCATACACCACCCATTTTTGCACTCCCAAATTCTCCATACTGCAATTTTCTGTA
JMFF023O10+ GCCAACCCATACACCACCCATTTTTGCACTCCCAAATTCTCCATA----------CTGTA
JMFF010G02+ GCCAACCCATACACCACCCATTTTTGCACTCCCAAATTCTCCATA----------CTGTA
JMSF044J19+ TGTA
JMSF023A01+ GCCAACCCATACACCACCCATTTTTGCACTCCCAAATTCTCCATA----------CTGTA
JMFF019K04+ CCACCCATTTTTGCACTCCCAAATTCTCCATA----------CTGTA
                      ____________________________________________________________
consensus GCCAACCCATACACCACCCATTTTTGCACTCCCAAATTCTCCATA----------CTGTA
 
. : . : . : . : . : . :
JMFF041O12+ TGATGGCAATAAAGACACGGAAGCTAAATTCTGGGGAAACTTAGTTACTCGGGTTTAGTA
JMFS108B04+ TGATGGCAATAAAGACACGGAAGCTAAATTCTGGGGAAACTTAGTTACTCGGGTTTAGTA
JMFF003D13+ TGATGGCAATAAAGACACGGAAGCTAAATTCTGGGGAAACTTAGTTACTCGGGTTTAGTA
JMFF017L13+ TGATGGCAATAAAGACACGGAAGCTAAATTCTGGGGAAACTTAGTTACTCGGGTTTAGTA
JMFF023O10+ TGATGGCAATAAAGACACGGAAGCTAAATTCTGGGGAAACTTAGTTACTCGGGTTTAGTA
JMFF010G02+ TGATGGCAATAAAGACACGGAAGCTAAATTCTGGGGAAACTTAGTTACTCGGGTTTAGTA
JMSF044J19+ TGATGGCAATAAAGACACGGAAGNTAAATTNNGGGGAAANNTAGTTACTCGGGNTTAGTA
JMSF023A01+ TGATGGCAATAAAGACACGGAAGCTAAATTCTGGGGAAACTTAGTTACTCGGGTTTAGTA
JMFF019K04+ TGATGGCAATAAAGACACGGAAGCTAAATTCTGGGGAAACTTAGTTACTCGGGTTTAGTA
                      ____________________________________________________________
consensus TGATGGCAATAAAGACACGGAAGCTAAATTCTGGGGAAACTTAGTTACTCGGGTTTAGTA
 
. : . : . : . : . : . :
JMFF041O12+ TCCTTAGTCTTGGAGGTTTCCAGCAGGATACGAACCACTGAACC
JMFS108B04+ TCCTTAGTCTTGGAGGTTTCCAGCAGGATACGAACCACTGAACCAGCTTT
JMFF003D13+ TCCTTAGTCTTGGAGGTTTCCAGCAGGATACGAACCACTGAACCAGCTTTTCTTCT
JMFF017L13+ TCCTTAGTCTTGGAGGTTTCCAGCAGGATACGAACCACTGAACCAGCTTTTCTTCTGTGA
JMFF023O10+ TCCTTAGTCTTGGAGGTTTCCAGCAGGATACGAACCACTGAACCAGCTTTTCTTCTGTGA
JMFF010G02+ TCCTTAGTCTTGGAGGTTTCCAGCAGGATACGAACCACTGAACCAGCTTTTCTTCTGTGA
JMSF044J19+ TCGNTAGTCTTGGAGGTTTCCAGCAGGATACGAACCACTGAACCAGCTTTTCTTCTGTGA
JMSF023A01+ TCCTTAGTCTTGGAGGTTTCCAGCAGGATACGAACCACTGAACCAGCTTTTCTTCTGTGA
JMFF019K04+ TCCTTAGTCTTGGAGGTTTCCAGCAGGATACGAACCACTGAACCAGCTTTTCTTCTGTGA
                      ____________________________________________________________
consensus TCCTTAGTCTTGGAGGTTTCCAGCAGGATACGAACCACTGAACCAGCTTTTCTTCTGTGA
 
. : . : . : . : . : . :
JMFF017L13+ GAAGTGAC
JMFF023O10+ GAAATGAC
JMFF010G02+ GAAGTGAC
JMSF044J19+ GAAGTGAC
JMSF023A01+ GAAGTGAC
JMFF019K04+ GAAGTGACGAGGACAAAGTGCTTTCAAGAATCACTTTTTATTAACGGAAAAGAGGATTGC
                      ____________________________________________________________
consensus GAAGTGACGAGGACAAAGTGCTTTCAAGAATCACTTTTTATTAACGGAAAAGAGGATTGC
 
. : . : . : . : . : . :
JMFF019K04+ ATTCTCTCGTGAAATTTAGCTTAAAGTTAATAATAATGAAGTAATACATGTAAAAGAATG
                      ____________________________________________________________
consensus ATTCTCTCGTGAAATTTAGCTTAAAGTTAATAATAATGAAGTAATACATGTAAAAGAATG
 
. : . : . : . : . : . :
JMFF019K04+ CACACGTATAGTGACACAACTTTTTTTTTCTTTCAAAAGATGGAAACTTTAAGGGCAACC
                      ____________________________________________________________
consensus CACACGTATAGTGACACAACTTTTTTTTTCTTTCAAAAGATGGAAACTTTAAGGGCAACC
 
. : . : . : . : . : . :
JMFF019K04+ GACAAAATTTTTTGACTTTTTTGGGATGGCGGATAGATAAATTCAAGCACCGATTCGTTT
                      ____________________________________________________________
consensus GACAAAATTTTTTGACTTTTTTGGGATGGCGGATAGATAAATTCAAGCACCGATTCGTTT
 
. : . : . : . : . : . :
JMFF019K04+ TATTTTTTTAAAAGTTGAATGAAGTGAAGAGCAGAACAGACATGCTGGGAATCTAGGATG
                      ____________________________________________________________
consensus TATTTTTTTAAAAGTTGAATGAAGTGAAGAGCAGAACAGACATGCTGGGAATCTAGGATG
 
. : . : . : . : . : . :
JMFF019K04+ TTGGATATGATGAGACCCGACCCGGGTGGTATTAGCTGGAAGCCTGTACAACCCCATTTT
                      ____________________________________________________________
consensus TTGGATATGATGAGACCCGACCCGGGTGGTATTAGCTGGAAGCCTGTACAACCCCATTTT