Previous Contig 000986:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019J01Sequence545000986 (4)gb:AY065198_15663521e-13Arabidopsis thaliana putative protein transport protein SEC12p (F2I9.9; At2g0147736009119 (4)gb:AB025619_15164137e-27Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBA10.
JMSF006E06Sequence397000986 (4)gb:AY065198_15663529e-10Arabidopsis thaliana putative protein transport protein SEC12p (F2I9.9; At2g0147
JMSF010B18Sequence230000986 (4)774009119 (4)pir|B84425|B844252e-39probable protein transport protein SEC12p [imported] - Arabidopsis thaliana>gb:A
JMSF029H10Sequence654000986 (4)pir|T48907|T489074e-32St12p protein [imported] - Arabidopsis thaliana>gb:ATHSEC12PL_1553385 Arabidopsi728009119 (4)gb:AB025619_15164132e-31Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBA10.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029H10+ ACACAAGAATGGGCATTGGCCTCATCAAT
                      ____________________________________________________________
consensus ACACAAGAATGGGCATTGGCCTCATCAAT
 
. : . : . : . : . : . :
JMSF029H10+ AATAATTTCCATGCTAGGCCATTTGAAAACTCTCAGCTTGCCATCCTCACCACCAACAGC
                      ____________________________________________________________
consensus AATAATTTCCATGCTAGGCCATTTGAAAACTCTCAGCTTGCCATCCTCACCACCAACAGC
 
. : . : . : . : . : . :
JMSF029H10+ AAGTAGAGAACCCTCATTGTTAAATGTTAGTGCTAATTGCTGTCCAACGTCTTCCAATTG
JMFF019J01+ AATTG
                      ____________________________________________________________
consensus AAGTAGAGAACCCTCATTGTTAAATGTTAGTGCTAATTGCTGTCCAACGTCTTCCAATTG
 
. : . : . : . : . : . :
JMSF029H10+ CTTAAGTAATCTCTCAGATAACTTCACACTTAAAGCACCATCATCTGTGTCACTGCCTGC
JMFF019J01+ CTTAAGTAATCTCTCAGATAACTTCACACTTAAAGCACCATCATCTGTGTCACTGCCTGC
                      ____________________________________________________________
consensus CTTAAGTAATCTCTCAGATAACTTCACACTTAAAGCACCATCATCTGTGTCACTGCCTGC
 
. : . : . : . : . : . :
JMSF029H10+ AT-GCACTCAAACCAACTGCAACTCTTTGGTAAGGAACAAACAAGACCTTCTCCCCCAGG
JMSF006E06+ CCCAGG
JMFF019J01+ ATCCCACTCAAACCAACTGCAACTCTTTGGTAAGGAAAAAATAAGACCTTCTCCCCCAGG
                      ____________________________________________________________
consensus ATCGCACTCAAACCAACTGCAACTCTTTGGTAAGGAACAAATAAGACCTTCTCCCCCAGG
 
. : . : . : . : . : . :
JMSF029H10+ GTGGACAGTCATCCTGTAAGGCAGATCACTGCCAGTTCCAAGCCTTGCCACAGGCAGATC
JMSF006E06+ GTGGACAGTCATCCTGTAAGGCAGATCACTGCCAGTTCCAAGCCTTGCCACAGGCAGATC
JMFF019J01+ GTGGACAGTCATCCTGTAAGGCAGATCACTGCCAGTTCCAAGCCTTGCCACAGGCAGATC
                      ____________________________________________________________
consensus GTGGACAGTCATCCTGTAAGGCAGATCACTGCCAGTTCCAAGCCTTGCCACAGGCAGATC
 
. : . : . : . : . : . :
JMSF029H10+ GGAGAGAAAGCTGGAATCGAAATCGAATCGAGCTAGAAGGATAGCATTGGGGATACCACT
JMSF006E06+ GGAGAGAAAGCTGGAATCGAAATCGAATCGAGCTAGAAGGATAGCATTGGGGATACCACT
JMFF019J01+ GGAGAGAAAGCTGGAATCGAAATCGAATCGAGCTAGAAGGATAGCATTGGGGATACCACT
                      ____________________________________________________________
consensus GGAGAGAAAGCTGGAATCGAAATCGAATCGAGCTAGAAGGATAGCATTGGGGATACCACT
 
. : . : . : . : . : . :
JMSF029H10+ ATTCCCTTCGCCGCCCCCTCCAGCCATGACGACGTAGTTGTGGGTGGCGATCAGAGGCGA
JMSF006E06+ ATTCCCTTCGCCGCCCCCTCCAGCCATGACGACGTAGTTGTGGGTGGCGATCAGAGGCGA
JMSF010B18+ CGATCAGAGGCGA
JMFF019J01+ ATTCCCTTCGCCGCCCCCTCCAGCCATGACGACGTAGTTGTGGGTGGCGATCAGAGGCGA
                      ____________________________________________________________
consensus ATTCCCTTCGCCGCCCCCTCCAGCCATGACGACGTAGTTGTGGGTGGCGATCAGAGGCGA
 
. : . : . : . : . : . :
JMSF029H10+ CTTGTCGGCGGCGTCCTTATCGTCACCATCTCCCTCTGGCGGCGGTTTGGGAGCAGATCT
JMSF006E06+ CTTGTCGGCGGCGTCCTTATCGTCACCATCTCCCTCTGGCGGCGGTTTGGGAGCAGATCT
JMSF010B18+ CTTGTCGGCGGCGTCCTTATCGTCACCATCTCCCTCTGGCGGCGGTTTGGGAGCAGATCT
JMFF019J01+ CTTGTCGGCGGCGTCCTTATCGTCACCATCTCCCTCTGGCGGCGGTTTGGGAGCAGATCT
                      ____________________________________________________________
consensus CTTGTCGGCGGCGTCCTTATCGTCACCATCTCCCTCTGGCGGCGGTTTGGGAGCAGATCT
 
. : . : . : . : . : . :
JMSF029H10+ GATGGCGCCAGGTGGAACCCAGGCAGCTCCGTAGACTGGGACCCCATACTTCTTGCAGCT
JMSF006E06+ GATGGCGCCAGGTGGAACCCAGGCAGCTCCGTAGACTGGGACCCCATACTTCTTGCAGCT
JMSF010B18+ GATGGCGCCAGGTGGAACCCAGGCAGCTCCGTAGACTGGGACCCCATACTTCTTGCAGCT
JMFF019J01+ GATGGCGCCAGGTGGAACCCTGGCAGCTCCGTAGACTGGGACCCCATACTTCTTGCAGCT
                      ____________________________________________________________
consensus GATGGCGCCAGGTGGAACCCAGGCAGCTCCGTAGACTGGGACCCCATACTTCTTGCAGCT
 
. : . : . : . : . : . :
JMSF029H10+ TTCATCGTTGGCCATAATCAAGTCTGCGGGTGATCTTAGAGTGTGAAACTACTGAAGATC
JMSF006E06+ TTCATCGTTGGCCATAATCAAGTCTGCGGGTGATCTTAGAGTGTGAAACTACTGAAGATC
JMSF010B18+ TTCATCGTTGGCCATAATCAAGTCTGCGGGTGATCTTAGAGTGTGAAACTACTGAAGATC
JMFF019J01+ TTCATCGTTGGCCATAATCAAGTCTGCGGGTGATCTTAGAGTGTGAAACTACTGAAGATC
                      ____________________________________________________________
consensus TTCATCGTTGGCCATAATCAAGTCTGCGGGTGATCTTAGAGTGTGAAACTACTGAAGATC
 
. : . : . : . : . : . :
JMSF029H10+ TGTGTTTCGATGTCCCCTATTCAA
JMSF006E06+ TGTGTTTCGATGTCCCCTATTCAA
JMSF010B18+ TGTGTTTCGATGTCCCCTATTCAACACAGT
JMFF019J01+ TGTGTTTCGATGTCCCCTATTCAACACAGTGAAGTCGATGACATTCGTTCATCCGGCTGT
                      ____________________________________________________________
consensus TGTGTTTCGATGTCCCCTATTCAACACAGTGAAGTCGATGACATTCGTTCATCCGGCTGT