Previous Contig 000981:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019H01Sequence565000981 (3)gb:AY087765_15727925e-30Arabidopsis thaliana clone 38286 mRNA, complete sequence.
JMFF050A11Sequence633000981 (3)gb:AY087765_15727923e-38Arabidopsis thaliana clone 38286 mRNA, complete sequence.617021880gb:AY087765_15727928e-35Arabidopsis thaliana clone 38286 mRNA, complete sequence.
JMSF019G21Sequence478000981 (3)gb:AY087765_15727928e-18Arabidopsis thaliana clone 38286 mRNA, complete sequence.187022871

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050A11+ GGAAGTGTGNAGTAGGTCCATTAGCTTCCTCTCATTCA
                      ____________________________________________________________
consensus GGAAGTGTGNAGTAGGTCCATTAGCTTCCTCTCATTCA
 
. : . : . : . : . : . :
JMFF050A11+ TGAAATCTATCATTCCATTATTACCAATNGTAGTGAAGGAAGTGAACATGTTGGCCAAGG
JMFF019H01+ AAGGAAGTGAACATGTTGGCCAAGG
                      ____________________________________________________________
consensus TGAAATCTATCATTCCATTATTACCAATNGTAGTGAAGGAAGTGAACATGTTGGCCAAGG
 
. : . : . : . : . : . :
JMFF050A11+ CATCATAGAGGTTTTGGTAGCTTGTGTATATCTTCAAGTCCACCTTTCTAAGGTAAGGCG
JMSF019G21+ CG
JMFF019H01+ CATCATAGAGGTTTTGGTAGCTTGTGTATATCTTCAAGTCCACCTTTCTAAGGTAAGGCG
                      ____________________________________________________________
consensus CATCATAGAGGTTTTGGTAGCTTGTGTATATCTTCAAGTCCACCTTTCTAAGGTAAGGCG
 
. : . : . : . : . : . :
JMFF050A11+ CACCATCCATGCACACCTTCACCAGATTTGCTGCACTGCTACTGCTGCTGCTACTACTAC
JMSF019G21+ CACCATCCATGCACACCTTCACCAGATTTGCTGCACTGCTACTGCTGCTGCTACTACTAC
JMFF019H01+ CACCATCCATGCACACCTTCACCAGATTTGCTGCACTGCTACTGCTGCTGCTACTACTAC
                      ____________________________________________________________
consensus CACCATCCATGCACACCTTCACCAGATTTGCTGCACTGCTACTGCTGCTGCTACTACTAC
 
. : . : . : . : . : . :
JMFF050A11+ TTTTCTCTTCTGATCCCTCCGTGTTGCTCTTCTGGGCCATCTTCTTTCTGTAATTCTTCA
JMSF019G21+ TTTTCTCTTCTGATCCCTCCGTGTTGCTCTTCTGGGCCATCTTCTTTCTGTAATTCTTCA
JMFF019H01+ TTTTCTCTTCTGATCCCTCCGTGTTGCTCTTCTGGGCCATCTTCTTTCTGTAATTCTTCA
                      ____________________________________________________________
consensus TTTTCTCTTCTGATCCCTCCGTGTTGCTCTTCTGGGCCATCTTCTTTCTGTAATTCTTCA
 
. : . : . : . : . : . :
JMFF050A11+ CTGGAGGCCAACCCACCACTTGTGCCTTGGGTGGTGGCATGATGGGATCCTTGAGGATAG
JMSF019G21+ CTGGAGGCCAACCCACCACTTGTGCCTTGGGTGGTGGCATGATGGGATCCTTGAGGATAG
JMFF019H01+ CTGGAGGCCAACCCACCACTTGTGCCTTGGGTGGTGGCATGATGGGATCCTTGAGGATAG
                      ____________________________________________________________
consensus CTGGAGGCCAACCCACCACTTGTGCCTTGGGTGGTGGCATGATGGGATCCTTGAGGATAG
 
. : . : . : . : . : . :
JMFF050A11+ GTTCATGGTGGGAAGAAGCAGAAGAAGAAGAAGAAGAAGCTTTCATCTTCTTGTCAGCAC
JMSF019G21+ GTTCATGGTGGGAAGAAGCAGAAGAAGAAGAAGAAGAAGCTTTCATCTTCTTGTCAGCAC
JMFF019H01+ GTTCATGGTGGGAAGAAGCAGAAGAAGAAGAAGAAGAAGCTTTCATCTTCTTGTCAGCAC
                      ____________________________________________________________
consensus GTTCATGGTGGGAAGAAGCAGAAGAAGAAGAAGAAGAAGCTTTCATCTTCTTGTCAGCAC
 
. : . : . : . : . : . :
JMFF050A11+ TATTGGGTTGAATTGGAAGGTTGAGTTTGAGGTCTACAGTCTCAGAAAACTCTCTTTTTC
JMSF019G21+ TATTGGGTTGAATTGGAAGGTTGAGTTTGAGGTCTACAGTCTCAGAAAACTCTCTTTTTC
JMFF019H01+ TATTGGGTTGAATTGGAAGGTTGAGTTTGAGGTCTACAGTCTCAGAAAACTCTCTTTTTC
                      ____________________________________________________________
consensus TATTGGGTTGAATTGGAAGGTTGAGTTTGAGGTCTACAGTCTCAGAAAACTCTCTTTTTC
 
. : . : . : . : . : . :
JMFF050A11+ TGGTTATCTTCAAGCACTCCGCAGATTCATTATTACCACCGGGGAGGCCAAGGCAAAGAT
JMSF019G21+ TGGTTATCTTCAAGCACTCCGCAGATTCATTATTACCACCGGGGAGGCCAAGGCAAAGAT
JMFF019H01+ TGGTTATCTTCAAGCACTCCGCAGATTCATTATTACCACCGGGGAGGCCAAGGCAAAGAT
                      ____________________________________________________________
consensus TGGTTATCTTCAAGCACTCCGCAGATTCATTATTACCACCGGGGAGGCCAAGGCAAAGAT
 
. : . : . : . : . : . :
JMFF050A11+ CAGTCTCTCCATGGATCAGCATTGTCGCCATTTTAATTTCTGGTTTACTCGTAGCTTCTC
JMSF019G21+ CAGTCTCTCCATGGATCAGCATTGTCGCCATTTTAATTTCTGGTTTACTCGTAGCTTCTC
JMFF019H01+ CAGTCTCTCCATGGATCAGCATTGTCGCCATTTTAATTTCTGGTTTACTCGTAGCTTCTC
                      ____________________________________________________________
consensus CAGTCTCTCCATGGATCAGCATTGTCGCCATTTTAATTTCTGGTTTACTCGTAGCTTCTC
 
. : . : . : . : . : . :
JMFF050A11+ TTTGATCACCTTCAATTGGATTCTATTCTTTCTCAATGACAACAGAGAGAGTAAT
JMSF019G21+ TTTGATCACCTTCAATTGGATTCTATTCTTTCTCAATGACAACAGAGAGAGTAAT
JMFF019H01+ TTTGATCACCTTCAATTGGATTCTATTCTTTCTCAATGACAACAGAGAGAGTAATGAGAT
                      ____________________________________________________________
consensus TTTGATCACCTTCAATTGGATTCTATTCTTTCTCAATGACAACAGAGAGAGTAATGAGAT