Previous Contig 000973:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003C14Sequence694000973 (60)gb:AP003301_18276783e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070768000973 (60)pir|T48201|T482018e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF004P15Sequence703000973 (60)gb:AP003301_18276782e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070785000973 (60)pir|T48201|T482018e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF007A16Sequence694000973 (60)gb:AP003301_18276786e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070893000973 (60)pir|T48201|T482011e-10hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF011O17Sequence669000973 (60)gb:AP003301_18276782e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070791000973 (60)gb:AP002912_18238765e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P002
JMFF012D06Sequence702000973 (60)gb:AP003301_18276788e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070836000973 (60)pir|T48201|T482019e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF013P13Sequence436000973 (60)gb:AP003301_18276781e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070835000973 (60)pir|T48201|T482011e-10hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF019A05Sequence658000973 (60)gb:AP003301_18276782e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070785000973 (60)pir|T48201|T482018e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF019B12Sequence706000973 (60)gb:AP003301_18276782e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070917000973 (60)pir|T48201|T482011e-10hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF026L03Sequence701000973 (60)gb:AP003301_18276782e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070890000973 (60)pir|T48201|T482011e-10hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF029E09Sequence663000973 (60)gb:AP003301_18276783e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070792000973 (60)pir|T48201|T482018e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF030L23Sequence670000973 (60)gb:AP003301_18276786e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070757000973 (60)pir|T48201|T482017e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF032E17Sequence661000973 (60)gb:AP003301_18276782e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070792000973 (60)pir|T48201|T482018e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF032F07Sequence668000973 (60)
JMFF035C21Sequence703000973 (60)gb:AP003301_18276782e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070783000973 (60)pir|T48201|T482018e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF035L15Sequence702000973 (60)gb:AP003301_18276786e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070787000973 (60)pir|T48201|T482011e-10hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF038N19Sequence693000973 (60)gb:AK028455_11610046e-06Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched library, clone:889000973 (60)pir|T48201|T482011e-10hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF039M04Sequence703000973 (60)pir|T00207|T002075e-06P109 protein - silkworm>gb:AB008449_1193131 Bombyx mori mRNA for BmP109, complet787000973 (60)pir|T48201|T482018e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF041B22Sequence626000973 (60)pir|T48201|T482017e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid607000973 (60)pir|T48201|T482012e-09hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF045J04Sequence622000973 (60)gb:AP003301_18276781e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070518000973 (60)pir|T46069|T460696e-07hypothetical protein T18N14.110 - Arabidopsis thaliana>gb:ATT18N14_1554790 Arabi
JMFF047H05Sequence641000973 (60)gb:AP003301_18276781e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070565000973 (60)pir|T46069|T460698e-07hypothetical protein T18N14.110 - Arabidopsis thaliana>gb:ATT18N14_1554790 Arabi
JMFF049I06Sequence601000973 (60)gb:AP003301_18276782e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070605000973 (60)pir|T48201|T482017e-10hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFF050B10Sequence603000973 (60)gb:AP003301_18276785e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070577000973 (60)pir|T46069|T460698e-07hypothetical protein T18N14.110 - Arabidopsis thaliana>gb:ATT18N14_1554790 Arabi
JMFF050H20Sequence622000973 (60)gb:AP003301_18276781e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070536000973 (60)pir|T46069|T460697e-07hypothetical protein T18N14.110 - Arabidopsis thaliana>gb:ATT18N14_1554790 Arabi
JMFF050I22Sequence632000973 (60)gb:AP003301_18276782e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070
JMFN009E18Sequence625000973 (60)gb:AP003301_18276781e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070
JMFN043D18Sequence613000973 (60)pir|T46069|T460692e-04hypothetical protein T18N14.110 - Arabidopsis thaliana>gb:ATT18N14_1554790 Arabi
JMFS002G02Sequence483000973 (60)pir|T48201|T482011e-08hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMFS031F08Sequence547000973 (60)pir|T46069|T460691e-04hypothetical protein T18N14.110 - Arabidopsis thaliana>gb:ATT18N14_1554790 Arabi
JMFS086D10Sequence611000973 (60)gb:AP003301_18276781e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070
JMFS162A11Sequence626000973 (60)gb:AP003301_18276781e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070
JMSF005O01Sequence344000973 (60)386000973 (60)pir|T46069|T460694e-06hypothetical protein T18N14.110 - Arabidopsis thaliana>gb:ATT18N14_1554790 Arabi
JMSF020F20Sequence702000973 (60)gb:AK028455_11610046e-06Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched library, clone:785000973 (60)pir|T48201|T482018e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMSF033E21Sequence700000973 (60)gb:AP003301_18276782e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070767000973 (60)pir|T48201|T482018e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid
JMSF047F19Sequence703000973 (60)gb:AK028455_11610046e-06Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched library, clone:785000973 (60)pir|T48201|T482018e-11hypothetical protein T20L15.70 - Arabidopsis thaliana>gb:ATT20L15_1555033 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047H05- ACTGAATGATACTTTGATAAATTCAAAAACAC
                      ____________________________________________________________
consensus ACTGAATGATACTTTGATAAATTCAAAAACAC
 
. : . : . : . : . : . :
rJMFF047H05- TAATTTGAAAATACACATTGAACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF050B10- TTTGAAAATACACATTGAACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF035L15- TTTGAAAATACACATTGAACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF049I06- AAATACACATTGAACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF041B22- TTGAAAATACACATTGAACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF050H20- AAATACACATTGAACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF045J04- TTTGGAAATACACATTGAACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF012D06- TTTGAAAATACACATTGAACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF013P13- ATTGAACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF038N19- TTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF039M04- TGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMSF020F20- ATTTGCGCAATACGCGTACAAGTGAACCA
rJMSF047F19- TATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF035C21- TTTGCGCAATACGCGTACAAGTGAACCA
rJMFF003C14- AACCA
rJMFF030L23- TTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMSF033E21- AGTGAACCA
rJMFF007A16- ACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF032E17- TTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF004P15- ATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF019B12- TTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF029E09- TTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF019A05- ATTTGCGCAATACGCGTACAAGTGAACCA
rJMFF026L03- TTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
                      ____________________________________________________________
consensus TAATTTGAAAATACACATTGAACATTGGATTATTTGCGCAATACGCGTACAAGTGAACCA
 
. : . : . : . : . : . :
rJMFF047H05- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF050B10- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF035L15- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF049I06- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF041B22- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF050H20- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF045J04- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF012D06- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF013P13- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF038N19- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF039M04- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMSF020F20- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMSF047F19- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF035C21- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMSF005O01- AGCAAGCAAACCACAGTCTACAACATGT
rJMFF003C14- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF030L23- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMSF033E21- CAGTCTACAACATGGTGAACAAGGGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF007A16- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF032E17- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF004P15- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF019B12- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF029E09- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF019A05- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
rJMFF026L03- CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
                      ____________________________________________________________
consensus CAGTCTACAACAT-GTGAACAA-GGTTGTAAAAGCAAGCAAACCACAGTCTACAACATGT
 
. : . : . : . : . : . :
rJMFF047H05- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF050B10- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF035L15- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF049I06- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF041B22- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF050H20- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF045J04- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF012D06- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF013P13- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF038N19- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF039M04- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMSF020F20- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMSF047F19- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF035C21- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
JMFS002G02+ ACAACAAGTGAACAAGGTTGCAAAAG
rJMSF005O01- GAACAAGGTTGTNAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF003C14- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF030L23- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAAGTTGCAAAAG
rJMSF033E21- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF007A16- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF032E17- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
JMFF041B22+ CAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF004P15- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF019B12- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF029E09- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF019A05- GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF026L03- GAACAAGGTTGTAAAAGCAAGCAAACCACGGTCTACAACAAGTGAACAAGGTTGCAAAAG
rJMFF011O17- GTCTACAACAAGTGAACAAGGTTGCAAAAG
                      ____________________________________________________________
consensus GAACAAGGTTGTAAAAGCAAGCAAACCACAGTCTACAACAAGTGAACAAGGTTGCAAAAG
 
. : . : . : . : . : . :
rJMFF047H05- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF050B10- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF035L15- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF049I06- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF041B22- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF050H20- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF045J04- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF012D06- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF013P13- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF038N19- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF039M04- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMSF020F20- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMSF047F19- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF035C21- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
JMFS002G02+ AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMSF005O01- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCANACCACAGTCT
rJMFF003C14- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF030L23- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMSF033E21- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF007A16- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF032E17- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
JMFF041B22+ AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF004P15- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF019B12- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF029E09- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF019A05- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF026L03- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
rJMFF011O17- AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
                      ____________________________________________________________
consensus AAAGCAAACCACAGTCTACAACATGTGAACAAGGTTGTAAAATAAAGCAAACCACAGTCT
 
. : . : . : . : . : . :
rJMFF047H05- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF050B10- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF035L15- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF049I06- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF041B22- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF050H20- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF045J04- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF012D06- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF013P13- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF038N19- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF039M04- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMSF020F20- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMSF047F19- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF035C21- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
JMFS002G02+ ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMSF005O01- ACNACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF003C14- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF030L23- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMSF033E21- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF007A16- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF032E17- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
JMFF041B22+ ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF004P15- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF019B12- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF029E09- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF019A05- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF026L03- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
rJMFF011O17- ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
                      ____________________________________________________________
consensus ACAACATGTGAACAAGCTAAGGTTTCCACTGGTTTTCTTCCTTAAGATGCAGAATGCTCA
 
. : . : . : . : . : . :
rJMFF047H05- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF050B10- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF035L15- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF049I06- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF041B22- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF050H20- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF045J04- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF012D06- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF013P13- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF038N19- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF039M04- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMSF020F20- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMSF047F19- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF035C21- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
JMFS002G02+ ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMSF005O01- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF003C14- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF030L23- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMSF033E21- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF007A16- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF032E17- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
JMFF041B22+ ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF004P15- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF019B12- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF029E09- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF019A05- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF026L03- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
rJMFF011O17- ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
                      ____________________________________________________________
consensus ATTCCAAGAGTTGGCGAGTCGCTAACATGCAGCAAAGTGCAGATGTCATTTGTTACTGGG
 
. : . : . : . : . : . :
rJMFF047H05- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF050B10- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF035L15- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF049I06- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF041B22- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF050H20- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF045J04- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF012D06- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF013P13- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF038N19- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF039M04- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMSF020F20- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMSF047F19- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF035C21- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
JMFS002G02+ AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMSF005O01- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF003C14- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF030L23- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMSF033E21- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF007A16- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF032E17- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
JMFF041B22+ AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF004P15- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF019B12- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF029E09- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF019A05- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF026L03- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
rJMFF011O17- AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
                      ____________________________________________________________
consensus AACTGCTCGGCGTTCACCAGAATTGGAGGGGCATATTCGAAAACAAGTTTCTTGCACTTT
 
. : . : . : . : . : . :
rJMFF047H05- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF050B10- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF035L15- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF049I06- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF041B22- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF050H20- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF045J04- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF012D06- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF013P13- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF038N19- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF039M04- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMSF020F20- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMSF047F19- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF035C21- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
JMFS002G02+ GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMSF005O01- GNTGAGAAATGGNAACAGC
rJMFF003C14- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF030L23- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMSF033E21- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF007A16- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF032E17- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
JMFF041B22+ GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF004P15- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF019B12- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF029E09- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF019A05- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF026L03- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
rJMFF011O17- GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
JMFN009E18+ AATTGAACAATTNGCAGAGACTTTCA-GG
JMFF029E09+ GAACANTTTGCAGAGACTTTCAGGG
JMFF007A16+ TTGAGAAATGGAAACAGCTCNTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
JMFF032E17+ CAATTTGCAGAGACTTTCA-GG
JMFF050I22+ GG
JMFF019A05+ CAATTNGCAGAGACTTTCA-GG
JMFS162A11+ A-GG
JMFF003C14+ TTGAGAAATGGAAACAGCTCNTT-CACAGAAATTGACCAATTTGCAGAGACTTTCA-GG
JMSF047F19+ TTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
JMFF035L15+ TTGAGAAATGGAANCAGCTCNTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
JMFF038N19+ TGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
JMFF026L03+ TTGAGAAATGGAANCAGCTCCTT-CACAGAAATTGAACAATT-GCAGAGACTTTCA-GG
JMFF039M04+ TTGAGAAATGGAANCAGCTCCTTCCACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
JMFF032F07+ CAATTTGCAGAGACTTTCA-GG
JMFF012D06+ TTGAGAAATGGAAACAGCTCNTT-CACAGAAATTGANCAATTTGCAGAGACTTTCA-GG
JMFF035C21+ TTGAGAAATGGAAACAGCTCNTTCCCCAGAAATTGAACAATTNGCAGAGACTTTCA-GG
JMFF011O17+ CAATTNGCAGAGACTTTCA-GG
JMFF004P15+ TTGAGAAATGGAAACAGCTCCTTCCCCAGAAATTGAACAATTTGCAGAGACTTTCA-GG
JMSF033E21+ TGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATT-GCAGAGACTTTCA-GG
JMSF020F20+ TGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
JMFF030L23+ CAATTTGCAGANACTTTCA-GG
JMFF019B12+ TGAGAAATGGAANCAGCTCCTT-CNCAGAAATTGANCAATTGGCAGAGACTTTCA-GG
                      ____________________________________________________________
consensus GTTGAGAAATGGAAACAGCTCCTT-CACAGAAATTGAACAATTTGCAGAGACTTTCA-GG
 
. : . : . : . : . : . :
rJMFF047H05- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAAT
rJMFF050B10- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF035L15- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF049I06- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF041B22- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAACG
rJMFF050H20- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF045J04- CGTTGAGGAGTTGATCAGTTTGAATAAATTA
rJMFF012D06- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF013P13- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF038N19- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF039M04- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMSF020F20- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMSF047F19- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF035C21- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFS002G02+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF003C14- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF030L23- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMSF033E21- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF007A16- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF032E17- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF041B22+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAACG
rJMFF004P15- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF019B12- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF029E09- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF019A05- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF026L03- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
rJMFF011O17- CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFN009E18+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF029E09+ CGTTGAGGAGCTGATCAGTCNGAATAAATTAGTAAGAATTG-GTTCAACCT-GGTTAATG
JMFF007A16+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF032E17+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF050I22+ CGTTGAGGAGTTGATCAGTT-GAAT-AATTAGTAAGAATGGTTTTCAAACT-GGTTAATG
JMFF019A05+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATGG-GTTCAAACT-GGTTAATG
JMFS162A11+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFS086D10+ AATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFN043D18+ ATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF003C14+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMSF047F19+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF035L15+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF038N19+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF026L03+ CGTGGAGGAGTTGATCAGTTNGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF039M04+ CGTTGAGGAGTTGATCAGTTNGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF032F07+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF012D06+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF035C21+ CGTGGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF045J04+ ATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF050H20+ G-GTTCAAACT-GGTTAATG
JMFF050B10+ TTCAAACT-GGTTAATG
JMFF049I06+ CAAACT-GGTTAATG
JMFF011O17+ CGTNGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF004P15+ NGTTGAGGAGTTGATCAGTTNGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMSF033E21+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMSF020F20+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF047H05+ GAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
JMFF030L23+ CGTTGAGGAGTTGATCAGTNNGAATAAATTAGTAAGANNGG-GTNCAAACTGGGTTAATG
JMFF019B12+ CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
                      ____________________________________________________________
consensus CGTTGAGGAGTTGATCAGTTTGAATAAATTAGTAAGAATTG-GTTCAAACT-GGTTAATG
 
. : . : . : . : . : . :
rJMFF050B10- CACTGTTGTGGGAA
rJMFF035L15- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF049I06- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF041B22- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF050H20- CACTGTTG
rJMFF012D06- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF013P13- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF038N19- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF039M04- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMSF020F20- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMSF047F19- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF035C21- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFS002G02+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCG
rJMFF003C14- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF030L23- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMSF033E21- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF007A16- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF032E17- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF041B22+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF004P15- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF019B12- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF029E09- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF019A05- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF026L03- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
rJMFF011O17- CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFN009E18+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF029E09+ CACTGTNGTGGGAAC-GGAAAATTTAATTGGGCAGAANCTGTGAAGGGCGTTAATTATCT
JMFF007A16+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF032E17+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF050I22+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF019A05+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFS162A11+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFS086D10+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFN043D18+ CACTGTTGTGGGAACGGGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFS031F08+ C-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF003C14+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMSF047F19+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF035L15+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF038N19+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF026L03+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF039M04+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF032F07+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF012D06+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF035C21+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF045J04+ CACTGTTGTGGGAAC-GGAAAA-TTAATTGNGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF050H20+ CACTGTTGTGGGAAC-GGAAAA-TTAATTGNGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF050B10+ CACTGTGNTGGGAAC-GGAAAA-TTAATTGNGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF049I06+ CACTGTGTGGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF011O17+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF004P15+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMSF033E21+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMSF020F20+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF047H05+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF030L23+ CACTGTTGTGGGANC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
JMFF019B12+ CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
                      ____________________________________________________________
consensus CACTGTTGTGGGAAC-GGAAAA-TTAATTTGGCAGAAACTGTGAAGGGCGTTAATTATCT
 
. : . : . : . : . : . :
rJMFF035L15- GGCTTTGTTTCTGCTTATCANAATAGGTGACCACNAGTTGTTTACACTTTAAGCACTGAT
rJMFF049I06- GGCTTTGTTTCTGCTTATC
rJMFF041B22- GGCTTTGTTTCTGCTTAT
rJMFF012D06- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF013P13- GGCTTTGTTTCTGCTTATCANAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF038N19- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF039M04- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMSF020F20- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMSF047F19- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF035C21- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF003C14- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF030L23- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMSF033E21- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF007A16- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF032E17- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF041B22+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF004P15- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF019B12- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF029E09- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF019A05- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF026L03- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
rJMFF011O17- GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFN009E18+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF029E09+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCANTGAT
JMFF007A16+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF032E17+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF050I22+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF019A05+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFS162A11+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFS086D10+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFN043D18+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFS031F08+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF003C14+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMSF047F19+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF035L15+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF038N19+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF026L03+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF039M04+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF032F07+ GGCTTNGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF012D06+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF035C21+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF045J04+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTNTACACTTTAAGCACTGAT
JMFF050H20+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTNTAAGCACTGAT
JMFF050B10+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTNTAAGCACTGAT
JMFF049I06+ GGCTTGTTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF011O17+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF004P15+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMSF033E21+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMSF020F20+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF047H05+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF030L23+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
JMFF019B12+ GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
                      ____________________________________________________________
consensus GGCTTTGTTTCTGCTTATCAGAATAGGTGACCACAAGTTGTTTACACTTTAAGCACTGAT
 
. : . : . : . : . : . :
rJMFF035L15- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGNGGATTCCCGCATATTGANAAATGGAA
rJMFF012D06- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF013P13- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGANAAATGGAA
rJMFF038N19- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF039M04- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMSF020F20- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMSF047F19- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF035C21- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF003C14- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF030L23- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMSF033E21- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF007A16- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF032E17- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF041B22+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF004P15- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF019B12- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF029E09- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF019A05- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF026L03- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
rJMFF011O17- CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFN009E18+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF029E09+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF007A16+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF032E17+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF050I22+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF019A05+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFS162A11+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFS086D10+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFN043D18+ CTTCATTTCCGCTAACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFS031F08+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF003C14+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMSF047F19+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF035L15+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF038N19+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF026L03+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF039M04+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF032F07+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF012D06+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF035C21+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF045J04+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF050H20+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF050B10+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF049I06+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF013P13+ TGGATT-CCGCATANNGAGAAATGGAA
JMFF011O17+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF004P15+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMSF033E21+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMSF020F20+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF047H05+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF030L23+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
JMFF019B12+ CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
                      ____________________________________________________________
consensus CTTCATTTCCGCTGACTTGAACTTGTTTCTCTGTGGATT-CCGCATATTGAGAAATGGAA
 
. : . : . : . : . : . :
rJMFF035L15- ACAACTCCTTCACANAACAATTTGCANATTGTTT-CAGGCGTTGA
rJMFF012D06- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGANGAGGAGATCATTTC
rJMFF013P13- ACAACTCCTTCACAGAACAATTTGCANATTGNTT-CAGGCGTTGANGANGANATCATTTC
rJMFF038N19- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGANGAGATCATTTC
rJMFF039M04- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
rJMSF020F20- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
rJMSF047F19- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
rJMFF035C21- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGANGAGGAGATCATTTC
rJMFF003C14- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CANGCGTTGAGGAGGAGATCATTTC
rJMFF030L23- ACNACTCCTTCNCAGAACAATTTGCAAATTGNTT-CAGGCGTTGAGGAGGAGATCATTTC
rJMSF033E21- ACAACTCCTTCNCAGAACAATTTGCAGATTGTTTCCAGGCGTTGAGGAGGAGATCATTTC
rJMFF007A16- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
rJMFF032E17- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF041B22+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
rJMFF004P15- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
rJMFF019B12- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGANGAGATCATTTC
rJMFF029E09- ACNACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGANGAGATCATTTC
rJMFF019A05- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGANGANGAGATCATTTC
rJMFF026L03- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
rJMFF011O17- ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFN009E18+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF029E09+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF007A16+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF032E17+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF050I22+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF019A05+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFS162A11+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFS086D10+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFN043D18+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFS031F08+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF003C14+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMSF047F19+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF035L15+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF038N19+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF026L03+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF039M04+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF032F07+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTT-AGGAGGAGATCATTTC
JMFF012D06+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF035C21+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF045J04+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF050H20+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF050B10+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF049I06+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF013P13+ ACNACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF011O17+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF004P15+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMSF033E21+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMSF020F20+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF047H05+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF030L23+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
JMFF019B12+ ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
                      ____________________________________________________________
consensus ACAACTCCTTCACAGAACAATTTGCAGATTGTTT-CAGGCGTTGAGGAGGAGATCATTTC
 
. : . : . : . : . : . :
rJMFF012D06- GAATATATTAAGGAAGCGNTTGATCCACATT-GNTAATGCACTG
rJMFF013P13- NAATATATTAAGGAAGCGNTTGATCCNCATTGGTTAATGCACTG
rJMFF038N19- GAATATATT-AGGAAGCGNTTGATCCACATT-GTTAATGCACTGNTGCCCCCACCCAGGA
rJMFF039M04- GAATATATT-AAGAAGCGTTTGATCCACATT-GTTAATGCACTG
rJMSF020F20- GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTG
rJMSF047F19- GAATATATT-AGGAAGCGTTTGATCCACATT-GNTNATGCACTGTTG
rJMFF035C21- NAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTG
rJMFF003C14- GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACG
rJMFF030L23- NAATATATT-AG
rJMSF033E21- NAATATATA-AGGAAGCGTTGNATCCNCATT-GNTAATGC
rJMFF007A16- GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGNTGCCCCCACGCAGGA
rJMFF032E17- GAATATATTAAGGAAGCGTTTGATCCACATT-GNTAATGCACTGTTG
JMFF041B22+ GA
rJMFF004P15- GAATATATTAAGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTG
rJMFF019B12- GAATATATTAAGGAAGCGTTTGATCCACATT-GNTAATGCACTGNTGCCCCCACGCAGGA
rJMFF029E09- GAATATATT-AGGAAGCGTTTGATCCACATTGGTAAATGCACTGTTG
rJMFF019A05- GAATATATT-ANGAAGCGTTTGATCCACATTGGTTAATGCACTG
rJMFF026L03- GAATATATT-AGGAAGCGTTTGATCCACATTGGTTAATGCACTGGTGCCCCCACGCAGGA
rJMFF011O17- GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFN009E18+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF029E09+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF007A16+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF032E17+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF050I22+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF019A05+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFS162A11+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFS086D10+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFN043D18+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFS031F08+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF003C14+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMSF047F19+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF035L15+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF038N19+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF026L03+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF039M04+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF032F07+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF012D06+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF035C21+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF045J04+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF050H20+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF050B10+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF049I06+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF013P13+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF011O17+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF004P15+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMSF033E21+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMSF020F20+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF047H05+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF030L23+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMSF005O01+ T-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
JMFF019B12+ GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
                      ____________________________________________________________
consensus GAATATATT-AGGAAGCGTTTGATCCACATT-GTTAATGCACTGTTGCCCCCACGCAGGA
 
. : . : . : . : . : . :
rJMFF038N19- TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAANGCTGGTAATTAACTCCCC
rJMFF007A16- TTATCCGTTATTGCACCAATATTTTTTGCAGTAATTGTGAAGGCTGNTAATTAACTNCCC
rJMFF019B12- TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAANGCTGGTAATTAACT-NCC
rJMFF026L03- TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAANGCTGTTAATTAACTCCCC
rJMFF011O17- TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAANGCTGTTAATTAACT-CCC
JMFN009E18+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF029E09+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF007A16+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF032E17+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF050I22+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF019A05+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFS162A11+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFS086D10+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFN043D18+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFS031F08+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF003C14+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMSF047F19+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF035L15+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF038N19+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF026L03+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF039M04+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF032F07+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF012D06+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF035C21+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF045J04+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF050H20+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF050B10+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF049I06+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF013P13+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF011O17+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF004P15+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMSF033E21+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMSF020F20+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF047H05+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF030L23+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMSF005O01+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
JMFF019B12+ TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
                      ____________________________________________________________
consensus TTATCCGTTATTGCACCAATA-TTTTTGCAGTAATTGTGAAGGCTGTTAATTAACT-CCC
 
. : . : . : . : . : . :
rJMFF038N19- TTTGNTTCTGCTCATCA
rJMFF007A16- TTTGTTTCTGCTCATCA
rJMFF019B12- TTTGGTTCTGCTCATCA
rJMFF026L03- TTTGNTTCTGCTCATCAAAATA
rJMFF011O17- TTTGTTTCTGCTCATCANAATANGTGGTCACAAATTCTTTACACTGTACGCAC
JMFN009E18+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF029E09+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF007A16+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF032E17+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF050I22+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF019A05+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFS162A11+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFS086D10+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFN043D18+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFS031F08+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF003C14+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMSF047F19+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF035L15+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF038N19+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF026L03+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF039M04+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF032F07+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF012D06+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF035C21+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF045J04+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF050H20+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF050B10+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF049I06+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF013P13+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF011O17+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF004P15+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMSF033E21+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMSF020F20+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF047H05+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF030L23+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMSF005O01+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
JMFF019B12+ TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
                      ____________________________________________________________
consensus TTTGTTTCTGCTCATCAGAATAGGTGGTCACAAATTCTTTACACTGTACGCACAGACTGC
 
. : . : . : . : . : . :
JMFN009E18+ CTTCAACTTGTTTCTTTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF029E09+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF007A16+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF032E17+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF050I22+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF019A05+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFS162A11+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFS086D10+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFN043D18+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFS031F08+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF003C14+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMSF047F19+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF035L15+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF038N19+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF026L03+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF039M04+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF032F07+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF012D06+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF035C21+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF045J04+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF050H20+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF050B10+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF049I06+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF013P13+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF011O17+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF004P15+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMSF033E21+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMSF020F20+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF047H05+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF030L23+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMSF005O01+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
JMFF019B12+ CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
                      ____________________________________________________________
consensus CTTCAACTTGTTTCTCTGAGACATCTAAGGATTGTGTCTTAAGGTCAGCAGCTGCTAAAT
 
. : . : . : . : . : . :
JMFN009E18+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF029E09+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF007A16+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF032E17+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF050I22+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF019A05+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFS162A11+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFS086D10+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFN043D18+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAAAAACAAAGCAGA
JMFS031F08+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF003C14+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMSF047F19+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF035L15+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF038N19+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF026L03+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF039M04+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF032F07+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF012D06+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF035C21+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF045J04+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF050H20+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF050B10+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF049I06+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF013P13+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF011O17+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF004P15+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMSF033E21+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMSF020F20+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF047H05+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF030L23+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMSF005O01+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
JMFF019B12+ CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
                      ____________________________________________________________
consensus CTTTTGCACTACAGCACCAGCTGCTAATAGCTAGTACAACAAGAACAACAACAAAGCAGA
 
. : . : . : . : . : . :
JMFN009E18+ GCCTTCT
JMFF029E09+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGT
JMFF007A16+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGT
JMFF032E17+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGT
JMFF050I22+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGT
JMFF019A05+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGT
JMFS162A11+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGA
JMFS086D10+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGT
JMFN043D18+ GCCTTCTATCCATGCCGGCCTCAGAGAGAG
JMFS031F08+ GCCTTCTATCCATGCCGGCCTCAGAGAGA
JMFF003C14+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGT
JMSF047F19+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGAC
JMFF035L15+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF038N19+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGT
JMFF026L03+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGAC
JMFF039M04+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGTGAATCAGTGAGAGTGAGAGACT
JMFF032F07+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF012D06+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF035C21+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF045J04+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF050H20+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGA
JMFF050B10+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF049I06+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF013P13+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF011O17+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF004P15+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGGGACT
JMSF033E21+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGA
JMSF020F20+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF047H05+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF030L23+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMSF005O01+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACT
JMFF019B12+ GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACTGATTC
                      ____________________________________________________________
consensus GCCTTCTATCCATGCCGGCCTCAGAGAGAGAGAGAATCAGTGAGAGTGAGAGACTGATTC