Previous Contig 000968:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018P04Sequence533000968 (5)675009092 (3)gb:AY087861_15728889e-09Arabidopsis thaliana clone 39013 mRNA, complete sequence.>gb:AY484700_1608340 Ar
JMFF022B09Sequence468000968 (5)
JMFF041M09Sequence651000968 (5)gb:AY087861_15728883e-07Arabidopsis thaliana clone 39013 mRNA, complete sequence.>gb:AY484700_1608340 Ar
JMFF050C21Sequence576000968 (5)gb:AY087861_15728884e-14Arabidopsis thaliana clone 39013 mRNA, complete sequence.>gb:AY484700_1608340 Ar547009092 (3)gb:AY087861_15728886e-04Arabidopsis thaliana clone 39013 mRNA, complete sequence.>gb:AY484700_1608340 Ar
JMSF036B06Sequence640000968 (5)gb:AY087861_15728882e-04Arabidopsis thaliana clone 39013 mRNA, complete sequence.>gb:AY484700_1608340 Ar748009092 (3)gb:AY087861_15728888e-18Arabidopsis thaliana clone 39013 mRNA, complete sequence.>gb:AY484700_1608340 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041M09+ GCCTGCTTCCGCACGTTGTGCCCCCTCACCAGC
                      ____________________________________________________________
consensus GCCTGCTTCCGCACGTTGTGCCCCCTCACCAGC
 
. : . : . : . : . : . :
JMFF050C21+ TGTAGCCTCACCAATCCCTTCAATGCCCGCAACGCCCGCCTGCANAGATATCCCCTG
JMFF041M09+ GCCTGTAGCCTCACCAATCCCTTCAATGCCCGCAACGCCCGCCTTGCAAGATATCCCCTG
JMSF036B06+ CACCAATCCCTTCAATGCCCGCAACGCCCGCCTTGCAAGATATCCCCTG
                      ____________________________________________________________
consensus GCCTGTAGCCTCACCAATCCCTTCAATGCCCGCAACGCCCGCCTTGCAAGATATCCCCTG
 
. : . : . : . : . : . :
JMFF050C21+ TAATATGACTGTATCATAACGGCAGCTCTGTCCTCGTTAGACTGGCGACCGAAGCCGGCT
JMFF041M09+ TAATATGACTGTATCATAACGGCAGCTCTGTCCTCGTTAGACTGGCGACCGAAGCCGGCT
JMSF036B06+ TAATATGACTGTATCATAACGGCAGCTCTGTCCTCGTTAGACTGGCGACCGAAGCCGGCT
                      ____________________________________________________________
consensus TAATATGACTGTATCATAACGGCAGCTCTGTCCTCGTTAGACTGGCGACCGAAGCCGGCT
 
. : . : . : . : . : . :
JMFF050C21+ AACCGGATAACCTTAGCGGCCGCCTGGGCCGCCGCAATGGCGGCCTCGGCAGCTGCGGCC
JMFF041M09+ AATCGGATAACCTTAGCGGCCGCCTGGGCCGCCGCAATGGCGGCCTCGGCAGCTGCGGCC
JMSF036B06+ AATCGGATAACCTTAGCGGCCGCCTGGGCCGCCGCAATGGCGGCCTCGGCAGCTGCGGCC
JMFF018P04+ TAACCTTAGCGGCCGCCTGGGCCGCCGCAATGGCGGCCTCGGCAGCTGCGGCC
                      ____________________________________________________________
consensus AATCGGATAACCTTAGCGGCCGCCTGGGCCGCCGCAATGGCGGCCTCGGCAGCTGCGGCC
 
. : . : . : . : . : . :
JMFF050C21+ GTCGCCACCGCAACGGCAATGGCATGGTCGCGATCCTCGGCCTCCGGAGACGACGGATCT
JMFF041M09+ GTCGCCACCGCAACGGCAATGGCATGGTCGCGATCCTCGGCCTCCGGAGACGACGGATCT
JMSF036B06+ GTCGCCACCGCAACGGCAATGGCATGGTCGCGATCCTCGGCCTCCGGAGACGACGGATCT
JMFF022B09+ AACGGCAATGGCATGGTCGCGATCCTCGGCCTCCGGAGACGACGGATCT
JMFF018P04+ GTCGCCACCGCAACGACAATGGCATGGTCGCGATCCTCGGCCTCCGGAGACGACGGATCT
                      ____________________________________________________________
consensus GTCGCCACCGCAACGGCAATGGCATGGTCGCGATCCTCGGCCTCCGGAGACGACGGATCT
 
. : . : . : . : . : . :
JMFF050C21+ TCATCACTCTTTCCGTCAGTAACATTAACCGGCGAATCTGGCTCAGCTGGCAAGCGATCA
JMFF041M09+ TCATCACTCTTTCCGTCAGTAACATTAACCGGCGAATCTGGCTCAGCTGGCAAGCGATCA
JMSF036B06+ TCATCACTCTTTCCGTCAGTAACATTAACCGGCGAATCTGGCTCAGCTGGCAAGCGATCA
JMFF022B09+ TCATCACTCTTTCCGTCAGTAACATTAACCGGCGAATCTGGCTCAGCTGGCAAGCGATCA
JMFF018P04+ TCATCACTCTTTCCGTCAGTAACATTAACCGGCGAATCTGGCTCAGCTGGCAAGCGATCA
                      ____________________________________________________________
consensus TCATCACTCTTTCCGTCAGTAACATTAACCGGCGAATCTGGCTCAGCTGGCAAGCGATCA
 
. : . : . : . : . : . :
JMFF050C21+ AGTGACACCACTTCTGCGGCTTCCCGCTGCCATTTTTGATCTACATTGTTTTCCTTCTTA
JMFF041M09+ AGTGACACCACTTCTGCGGCTTCCCGCTGCCATTTTTGATCTACATTGTTTTCCTTCTTA
JMSF036B06+ AGTGACACCACTTCTGCGGCTTCCCGCTGCCATTTTTGATCTACATTGTTTTCCTTCTTA
JMFF022B09+ AGTGACACCACTTCTGCGGCTTCCCGCTGCCATTTTTGATCTACATTGTTTTCCTTCTTA
JMFF018P04+ AGTGACACCACTTCTGCGGCTTCCCGCTGCCATTTTTGATCTACATTGTTTTCCTTCTTA
                      ____________________________________________________________
consensus AGTGACACCACTTCTGCGGCTTCCCGCTGCCATTTTTGATCTACATTGTTTTCCTTCTTA
 
. : . : . : . : . : . :
JMFF050C21+ TCCCGTGAAGAGCTTTTGAACACTTTCTTCACGCTGGAAAACCAGCCACTCCCTATCTTC
JMFF041M09+ TCCCGTGAAGAGCTTTTGAACACTTTCTTCACGCTGGAAAACCAGCCACTCCCTATCTTC
JMSF036B06+ TCCCGTGAAGAGCTTTTGAACACTTTCTTCACGCTGGAAAACCAGCCACTCCCTATCTTC
JMFF022B09+ TCCCGTGAAGAGCTTTTGAACACTTTCTTCACGCTGGAAAACCAGCCACTCCCTATCTTC
JMFF018P04+ TCCCGTGAAGAGCTTTTGAACACTTTCTTCACGCTGGAAAACCAGCCACTCCCTATCTTC
                      ____________________________________________________________
consensus TCCCGTGAAGAGCTTTTGAACACTTTCTTCACGCTGGAAAACCAGCCACTCCCTATCTTC
 
. : . : . : . : . : . :
JMFF050C21+ CCCATCTCCACCGACGCTTAACCATGAAAGTCGCCAAGATCTGA
JMFF041M09+ CCCATCTCCACCGACGCTTAACCATGAAAGTCGCCAAGATCTGATCGAATAAAATTATTG
JMSF036B06+ CCCATCTCCACCGACGCTTAACCATGAAAGTCGCCAAGATCTGATCGAATAAAATTATTG
JMFF022B09+ CCCATCTCCACCGACGCTTAACCATGAAAGTCGCCAAGATCTGATCGAATAAAATTATTG
JMFF018P04+ CCCATCTCCACCGACGCTTAACCATGAAAGTCGCCAAGATCTGATCGAATAAAATTATTG
                      ____________________________________________________________
consensus CCCATCTCCACCGACGCTTAACCATGAAAGTCGCCAAGATCTGATCGAATAAAATTATTG
 
. : . : . : . : . : . :
JMFF041M09+ ATTAAACTATCAGGTAGTGTTTTGGACGGCACCTGTGGTCTTCACTGACATGTCTTGAAA
JMSF036B06+ ATTAAACTATCAGGTAGTGTTTTGGACGGCACCTGTGGTCTTCACTGACATGTCTTGAAA
JMFF022B09+ ATTAAACTATCAGGTAGTGTTTTGGACGGCACCTGTGGTCTTCACTGACATGTCTTGAAA
JMFF018P04+ ATTAAACTATCAGGTAGTGTTTTGGACGGCACCTGTGGTCTTCACTGACATGTCTTGAAA
                      ____________________________________________________________
consensus ATTAAACTATCAGGTAGTGTTTTGGACGGCACCTGTGGTCTTCACTGACATGTCTTGAAA
 
. : . : . : . : . : . :
JMFF041M09+ GCTTGGATTGTAGAGAGTGAGGGAATGAAAGAAATTTTTGTACAGAGATGGTGTCTGTTG
JMSF036B06+ GCTTGGATTGTAGAGAGTGAGGGAATGAAAGAAATTTTTGTACAGAGATGGTGTCTGTTG
JMFF022B09+ GCTTGGATTGTAGAGAGTGAGGGAATGAAAGAAATTTTTGTACAGAGATGGTGTCTGTTG
JMFF018P04+ GCTTGGATTGTAGAGAGTGAGGGAATGAAAGAAATTTTTGTACAGAGATGGTGTCTGTTG
                      ____________________________________________________________
consensus GCTTGGATTGTAGAGAGTGAGGGAATGAAAGAAATTTTTGTACAGAGATGGTGTCTGTTG
 
. : . : . : . : . : . :
JMFF041M09+ TTCAGAGAGAGAGAGAAT
JMSF036B06+ TTCAGAGAGAGAGAGAATGAAGAAATGAATAATATTTACGAGTAAAAGAC
JMFF022B09+ TTCAGAGAGAGAGAGAATGAAGAAATGAATAATATTTACGAGTAAAAGACAGCACTAAC
JMFF018P04+ TTCAGAGAGAGAGAGAATGAAGAAATGAATAATATTTACGAGTAAAAGACAGCACTAACT
                      ____________________________________________________________
consensus TTCAGAGAGAGAGAGAATGAAGAAATGAATAATATTTACGAGTAAAAGACAGCACTAACT