Previous Contig 000964:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015I14Sequence575000964 (12)sp|O23708|PSA2_ARATH1e-78Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>668000964 (12)sp|O23708|PSA2_ARATH1e-71Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>
JMFF018M16Sequence568000964 (12)sp|O23708|PSA2_ARATH2e-73Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>782000964 (12)sp|O23708|PSA2_ARATHe-100Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>
JMFF027C01Sequence571000964 (12)sp|O23708|PSA2_ARATH6e-74Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>727000964 (12)sp|O23708|PSA2_ARATH2e-90Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>
JMFF041G08Sequence636000964 (12)sp|O23708|PSA2_ARATH1e-98Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>607000964 (12)sp|O23708|PSA2_ARATH6e-65Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>
JMFN016K02Sequence612000964 (12)sp|O23708|PSA2_ARATH4e-97Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>
JMFN040H09Sequence625000964 (12)sp|O23708|PSA2_ARATH3e-95Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>
JMFS135D09Sequence598000964 (12)sp|O23708|PSA2_ARATH8e-85Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>
JMSF023H02Sequence621002154 (5)gb:AB010071_15108885e-31Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15.>gb:AY042897_1560254000964 (12)sp|O23708|PSA2_ARATH9e-37Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B).>

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF041G08- CTACAAAGCCATAAATCAACC
                      ____________________________________________________________
consensus CTACAAAGCCATAAATCAACC
 
. : . : . : . : . : . :
rJMFF041G08- AGAACTGAAGTAAAATCAGGATTTAAGTTACACATGAACGCCAGAGCAGTCTAGATTTGG
rJMFF015I14- CTGAAGTAAAATCAGGATTTAAGTTACACATGAACGCCAGAGCAGTCTAGATTTGG
rJMFF027C01- CTGAAGTAAAATCAGGATTTAAGTTACACATGAACGCCAGAGCAGTCTAGATTTGG
rJMFF018M16- CTGAAGTAAAATCAGGATTTAAGTTACACATGAACGCCAGAGCAGTCTAGATTTGG
                      ____________________________________________________________
consensus AGAACTGAAGTAAAATCAGGATTTAAGTTACACATGAACGCCAGAGCAGTCTAGATTTGG
 
. : . : . : . : . : . :
rJMFF041G08- CAGTTCAAAAGTTTGAATAAACAACAAAGTCTGATGATAGATAGTCGCGTTGCACAAAAC
rJMFF015I14- CAGTTCAAAAGTTTGAATAAACAACAAAGTCTGATGATAGATAGTCGCGTTGCACAAAAC
rJMFF027C01- CAGTTCAAAAGTTTGAATAAACAACAAAGTCTGATGATAGATAGTCGCGTTGCACAAAAC
rJMFF018M16- CAGTTCAAAAGTTTGAATAAACAACAAAGTCTGATGATAGATAGTCGCGTTGCACAAAAC
                      ____________________________________________________________
consensus CAGTTCAAAAGTTTGAATAAACAACAAAGTCTGATGATAGATAGTCGCGTTGCACAAAAC
 
. : . : . : . : . : . :
rJMFF041G08- AAATCTTTCTTTGTTGTTTCCTAACATAAAGTGAACATTTTCCACGCACCCTCAAGAAAA
rJMFF015I14- AAATCTTTCTTTGTTGTTTCCTAACATAAAGTGAACATTTTCCACGCACCCTCAAGAAAA
rJMFF027C01- AAATCTTTCTTTGTTGTTTCCTAACATAAAGTGAACATTTTCCACGCACCCTCAAGAAAA
rJMFF018M16- AAATCTTTCTTTGTTGTTTCCTAACATAAAGTGAACATTTTCCACGCACCCTCAAGAAAA
                      ____________________________________________________________
consensus AAATCTTTCTTTGTTGTTTCCTAACATAAAGTGAACATTTTCCACGCACCCTCAAGAAAA
 
. : . : . : . : . : . :
rJMFF041G08- ACTTTACTACTCCACTTCCTGTAGGTAGTCATCAATTTCAGCAGGCGTAAGGACTCTGAA
rJMFF015I14- ACTTTACTACTCCACTTCCTGTAGGTAGTCATCAATTTCAGCAGGCGTAAGGACTCTGAA
rJMFF027C01- ACTTTACTACTCCACTTCCTGTAGGTAGTCATCAATTTCAGCAGGCGTAAGGACTCTGAA
rJMSF023H02- CGTANGGACTCTGAA
rJMFF018M16- ACTTTACTACTCCACTTCCTGTAGGTAGTCATCAATTTCAGCAGGCGTAAGGACTCTGAA
                      ____________________________________________________________
consensus ACTTTACTACTCCACTTCCTGTAGGTAGTCATCAATTTCAGCAGGCGTAAGGACTCTGAA
 
. : . : . : . : . : . :
rJMFF041G08- CACTTAGTCAGCACCAATTATGCCAATCTCAATGTTTTTACCAGAAATTTGCCCTTCAAA
rJMFF015I14- CACTTTGTCAGCACCAATTATGCCAATCTCAATGTTTTTACCAGAAATTTGCCCTTCAAA
rJMFF027C01- CACTTTGTCAGCACCAATTATGCCAATCTCAATGTTTTTACCAGAAATTTGCCCTTCAAA
rJMSF023H02- CACTTTGTCAGCACCAATTATGCCAATCTCANTGTTTTTACCAGAAATTTGCCCTTCAAA
rJMFF018M16- CACTTTGTCAGCACCAATTATGCCAATCTCAATGTTTTTACCAGAAATTTGCCCTTCAAA
                      ____________________________________________________________
consensus CACTTTGTCAGCACCAATTATGCCAATCTCAATGTTTTTACCAGAAATTTGCCCTTCAAA
 
. : . : . : . : . : . :
rJMFF041G08- TCCCTCCTTCAGTGTCAGAATAGCAGTGTGTACAGCATCATCAAGTTCCATATCTTCTGT
rJMFF015I14- TCCCTCCTTCAGTGTCAGAATAGCAGTGTGTACAGCATCATCAAGTTCCATATCTTCTGT
rJMFF027C01- TCCCTCCTTCAGTGTCAGAATAGCAGTGTGTACAGCATCATCAAGTTCCATATCTTCTGT
rJMSF023H02- TCCCTCCTTCAGTGTCAGAATAGCAGTGTGNACAGCATCATCNAGTTCCATATCNTCNGN
rJMFF018M16- TCCCTCCTTCAGTGTCAGAATAGCAGTGTGTACAGCATCATCAAGTTCCATATCTTCTGT
JMFN016K02+ AGCATCATCAAGTTCCATATCTTCTGT
JMFF041G08+ TAGCAGTGTGTACAGCATCATCAAGTTCCATATCTTCTGT
JMFN040H09+ CAAGTTCCATATCTTCTGT
                      ____________________________________________________________
consensus TCCCTCCTTCAGTGTCAGAATAGCAGTGTGTACAGCATCATCAAGTTCCATATCTTCTGT
 
. : . : . : . : . : . :
rJMFF041G08- ATACCTCTTCTCAAGAAATGTCTTCGCATTAGACACATTCTTCCCCATGGCTGAAGCCTT
rJMFF015I14- ATACCTCTTCTCAAGAA--GTCTTCGCATTAGACACATTCTTCCCCATGGCTGAAGCCTT
rJMFF027C01- ATACCTCTTCTCAAGAAATGTCTTCGCATTAGACACATTCTTCCCCATGGCTGAAGCCTT
rJMSF023H02- ATACCTCTTCTCAAGANATGTCTTCGCATTAGACACATTCTTCCCCATGGCTGANGCCTT
rJMFF018M16- ATACCTCTTCTCAAGAAATGTCTTCGCATTAGACACATTCTTCCCCATGGCTGAAGCCTT
JMFN016K02+ ATACCTCTTCTCAAGAAATGTCTTCGCATTAGACACATTCTTCCCCATGGCTGAAGCCTT
JMFF041G08+ ATACCTCTTCTCAAGAAATGTCTTCGCATTAGACACATTCTTCNCCATGGCTGAAGCCTT
JMFN040H09+ ATACCTCTTCTCAAGAAATGTCTTCGCATTAGACACATTCTTCCCCATGGCTGAAGCCTT
JMFF015I14+ GGCTGAAGCCTT
JMFS135D09+ CATTCTTCCCCATGGCTGAAGCCTT
                      ____________________________________________________________
consensus ATACCTCTTCTCAAGAAATGTCTTCGCATTAGACACATTCTTCCCCATGGCTGAAGCCTT
 
. : . : . : . : . : . :
rJMFF041G08- CCAGGAG-AAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
rJMFF015I14- CCAGGAG-AAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
rJMFF027C01- CCAGGAG-AAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
rJMSF023H02- CCAGGAG-AAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
rJMFF018M16- CCAGGAG-AAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
JMFN016K02+ CCAGGAG-AAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
JMFF041G08+ CCAGGAG-AAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
JMFN040H09+ CCAGGAG-AAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
JMFF015I14+ CCAGGAGAAAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
JMFS135D09+ CCAGGAG-AAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
JMFF027C01+ CACCTGATACAGCTGGGGACCCTTGTCATCAA
JMFF018M16+ CTGATACAGCTGGGGACCCTTGTCATCAA
                      ____________________________________________________________
consensus CCAGGAG-AAGTATGAACCTGAAGGATCCACCTGATACAGCTGGGGACCCTTGTCATCAA
 
. : . : . : . : . : . :
rJMFF041G08- ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
rJMFF015I14- ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
rJMFF027C01- ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
rJMFF018M16- ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
JMFN016K02+ ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
JMFF041G08+ ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
JMFN040H09+ ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
JMFF015I14+ ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
JMFS135D09+ ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
JMFF027C01+ ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
JMFF018M16+ ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
                      ____________________________________________________________
consensus ACCCAGCAACCAAGAGAGAAACACCAAATGGCCTTACACCACCTGATTGAGTGAATTCCT
 
. : . : . : . : . : . :
rJMFF041G08- GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGT
rJMFF015I14- GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACAGGGGATTGGTTCTTTATAGAGG
rJMFF027C01- GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGTTCTTTATAGAGG
rJMFF018M16- GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGTTCTTTATAGAGG
JMFN016K02+ GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGTTCTTTATAGAGG
JMFF041G08+ GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGTTCTTTATAGAGG
JMFN040H09+ GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGTTCTTTATAGAGG
JMFF015I14+ GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGTTCTTTATAGAGG
JMFS135D09+ GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGTTCTTTATAGAGG
JMFF027C01+ GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGTTCTTTATAGAGG
JMFF018M16+ GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGTTCTTTATAGAGG
                      ____________________________________________________________
consensus GCATCACTGCTGCGGTTTCCCTCACAAGTTGCGTGACA-GGGATTGGTTCTTTATAGAGG
 
. : . : . : . : . : . :
rJMFF015I14- CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTANAATCAGGTCCC
rJMFF027C01- CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTAGAATCAGGTCCC
rJMFF018M16- CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTAGAATCAGGTCCC
JMFN016K02+ CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTAGAATCAGGTCCC
JMFF041G08+ CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTAGAATCAGGTCCC
JMFN040H09+ CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTAGAATCAGGTCCC
JMFF015I14+ CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTAGAATCAGGTCCC
JMFS135D09+ CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTAGAATCAGGTCCC
JMFF027C01+ CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTAGAATCAGGTCCC
JMFF018M16+ CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTAGAATCAGGTCCC
                      ____________________________________________________________
consensus CGGTGATATTGTTCGGCTTGTTTCCTACTTTTCCGAACCAAAACTCTAGAATCAGGTCCC
 
. : . : . : . : . : . :
rJMFF015I14- ATGCCACTGTATA
rJMFF027C01- ATGCCACTGTATACNACTCCNATATTTGGTGTCAAAATCTGAATCTTTTGCACAGAAGCT
rJMFF018M16- ATGCCACTGTATACAACTCCAATATTTGGTGTCAAAATCTGAATCTTTTGCACAGAAGCT
JMFN016K02+ ATGCCACTGTATACAACTCCAATATTTGGTGTCAAAATCTGAATCTTTTGCACAGAAGCT
JMFF041G08+ ATGCCACTGTATACAACTCCAATATTTGGTGTCAAAATCTGAATCTTTTGCACAGAAGCT
JMFN040H09+ ATGCCACTGTATACAACTCCAATATTTGGTGTCAAAATCTGAATCTTTTGCACAGAAGCT
JMFF015I14+ ATGCCACTGTATACAACTCCAATATTTGGTGTCAAAATCTGAATCTTTTGCACAGAAGCT
JMFS135D09+ ATGCCACTGTATACAACTCCAATATTTGGTGTCAAAATCTGAATCTTTTGCACAGAAGCT
JMFF027C01+ ATGCCACTGTATACAACTCCAATATTTGGTGTCAAAATCTGAATCTTTTGCACAGAAGCT
JMFF018M16+ ATGCCACTGTATACAACTCCAATATTTGGTGTCAAAATCTGAATCTTTTGCACAGAAGCT
                      ____________________________________________________________
consensus ATGCCACTGTATACAACTCCAATATTTGGTGTCAAAATCTGAATCTTTTGCACAGAAGCT
 
. : . : . : . : . : . :
rJMFF027C01- TCATCAACCAAGA
rJMFF018M16- TCATCAACCAAGATGGATGGTAGTTTCTTCTCAGTTGCAATAACAACACCATTAGAAGCT
JMFN016K02+ TCATCAACCAAGATGGATGGTAGTTTCTTCTCAGTTGCAATAACAACACCATTAGAAGCT
JMFF041G08+ TCATCAACCAAGATGGATGGTAGTTTCTTCTCAGTTGCAATAACAACACCATTAGAAGCT
JMFN040H09+ TCATCAACCAAGATGGATGGTAGTTTCTTCTCAGTTGCAATAACAACACCATTAGAAGCT
JMFF015I14+ TCATCAACCAAGATGGATGGTAGTTTCTTCTCAGTTGCAATAACAACACCATTAGAAGCT
JMFS135D09+ TCATCAACCAAGATGGATGGTAGTTTCTTCTCAGTTGCAATAACAACACCATTAGAAGCT
JMFF027C01+ TCATCAACCAAGATGGATGGTAGTTTCTTCTCAGTTGCAATAACAACACCATTAGAAGCT
JMFF018M16+ TCATCAACCAAGATGGATGGTAGTTTCTTCTCAGTTGCAATAACAACACCATTAGAAGCT
                      ____________________________________________________________
consensus TCATCAACCAAGATGGATGGTAGTTTCTTCTCAGTTGCAATAACAACACCATTAGAAGCT
 
. : . : . : . : . : . :
rJMFF018M16- TTTATC
JMFN016K02+ TTTATCCCTAAAGATGTTTGCCCGGAACCAACAGCCGTTAAGGCATGTTCAATCTGAACT
JMFF041G08+ TTTATCCCTAAAGATGTTTGCCCGGAACCAACAGCCGTTAAGGCATGTTCAATCTGAACT
JMFN040H09+ TTTATCCCTAAAGATGTTTGCCCGGAACCAACAGCCGTTAAGGCATGTTCAATCTGAACT
JMFF015I14+ TTTATCCCTAAAGATGTTTGCCCGGAACCAACAGCCGTTAAGGCATGTTCAATCTGAACT
JMFS135D09+ TTTATCCCTAAAGATGTTTGCCCGGAACCAACAGCCGTTAAGGCATGTTCAATCTGAACT
JMFF027C01+ TTTATCCCTAAAGATGTTTGCCCGGAACCAACAGCCGTTAAGGCATGTTCAATCTGAACT
JMFF018M16+ TTTATCCCTAAAGATGTTTGCCCGGAACCAACAGCCGTTAAGGCATGTTCAATCTGAACT
                      ____________________________________________________________
consensus TTTATCCCTAAAGATGTTTGCCCGGAACCAACAGCCGTTAAGGCATGTTCAATCTGAACT
 
. : . : . : . : . : . :
JMFN016K02+ AGTTTTCCAGAAGGGCTGAACGTGGTAAGGGAAAATGAGTATTGACTGTCTCCCATCAGA
JMFF041G08+ AGTTTTCCAGAAGGGCTGAACGTGGTAAGGGAAAATGAGTATTGACTGTCTCCCATCAGA
JMFN040H09+ AGTTTTCCAGAAGGGCTGAACGTGGTAAGGGAAAATGAGTATTGACTGTCTCCCATCAGA
JMFF015I14+ AGTTTTCCAGAAGGGCTGAACGTGGTAAGGGAAAATGAGTATTGACTGTCTCCCATCAGA
JMFS135D09+ AGTTTTCCAGAAGGGCTGAACGTGGTAAGGGAAAATGAGTATTGACTGTCTCCCATCAGA
JMFF027C01+ AGTTTTCCAGAAGGGCTGAACGTGGTAAGGGAAAATGAGTATTGACTGTCTCCCATCAGA
JMFF018M16+ AGTTTTCCAGAAGGGCTGAACGTGGTAAGGGAAAATGAGTATTGACTGTCTCCCATCAGA
                      ____________________________________________________________
consensus AGTTTTCCAGAAGGGCTGAACGTGGTAAGGGAAAATGAGTATTGACTGTCTCCCATCAGA
 
. : . : . : . : . : . :
JMFN016K02+ TATTGTAAAGCTCTAGTAAATGCTCTGGGCAATGTCGAGGCAGCGAA
JMFF041G08+ TATTGTAAAGCTCTAGTAAATGCTCTGGGCAATGTCGAGGCAGCGAAGAATTCTTCAC
JMFN040H09+ TATTGTAAAGCTCTAGTAAATGCTCTGGGCAATGTCGAGGCAGCGAAGAATTCTTCACGG
JMFF015I14+ TATTGTAAAGCTCTAGTAAATGCTCTGGGCAATGTCGAGGCAGCGAAGAATTCTTCACGG
JMFS135D09+ TATTGTAAAGCTCTAGTAAATGCTCTGGGCAATGTCGAGGCAGCGAAGAATTCTTCACGG
JMFF027C01+ TATTGTAAAGCTCTAGTAAATGCTCTGGGCAATGTCGAGGCAGCGAAGAATTCTTCACGG
JMFF018M16+ TATTGTAAAGCTCTAGTAAATGCTCTGGGCAATGTCGAGGCAGCGAAGAATTCTTCACGG
                      ____________________________________________________________
consensus TATTGTAAAGCTCTAGTAAATGCTCTGGGCAATGTCGAGGCAGCGAAGAATTCTTCACGG
 
. : . : . : . : . : . :
JMFN040H09+ AAGCTTGA
JMFF015I14+ AAGCTTGAGAATAGGGATACTTCT
JMFS135D09+ AAGCTTGAGAATAGGGATACTTCTAGCTTTAGTTC
JMFF027C01+ AAGCTTGAGAATAGGGATACTTCTAGCTTTAGTTCGACTTGGGGAGAAAGAAATAAAAGG
JMFF018M16+ AAGCTTGAGAATAGGGATACTTCTAGCTTTAGTTCGACTTGGGGAGAAAGAAATAAAAGG
                      ____________________________________________________________
consensus AAGCTTGAGAATAGGGATACTTCTAGCTTTAGTTCGACTTGGGGAGAAAGAAATAAAAGG