Previous Contig 000962:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018M09Sequence589000962 (7)gb:AY088169_15731916e-15Arabidopsis thaliana clone 42402 mRNA, complete sequence.>gb:BT004014_1637128 Ar776021084gb:AY088169_15731914e-37Arabidopsis thaliana clone 42402 mRNA, complete sequence.>gb:BT004014_1637128 Ar
JMFF046B03Sequence570000962 (7)gb:AY088169_15731916e-15Arabidopsis thaliana clone 42402 mRNA, complete sequence.>gb:BT004014_1637128 Ar375000962 (7)gb:AC135958_17429677e-15Oryza sativa chromosome 3 BAC OSJNBa0059E14 genomic sequence, complete sequence.
JMSF029D09Sequence618000962 (7)gb:AY088169_15731912e-44Arabidopsis thaliana clone 42402 mRNA, complete sequence.>gb:BT004014_1637128 Ar742000962 (7)gb:AY088169_15731912e-43Arabidopsis thaliana clone 42402 mRNA, complete sequence.>gb:BT004014_1637128 Ar
JMSF032B15Sequence735000962 (7)gb:AY088169_15731916e-44Arabidopsis thaliana clone 42402 mRNA, complete sequence.>gb:BT004014_1637128 Ar754000962 (7)gb:AY088169_15731912e-43Arabidopsis thaliana clone 42402 mRNA, complete sequence.>gb:BT004014_1637128 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032B15- ACATCACACT
                      ____________________________________________________________
consensus ACATCACACT
 
. : . : . : . : . : . :
rJMSF032B15- AGTAACATACTCCTTATTAAATACCACCATAAGAACTCTAAATTAACCTCTAAGGTCCCA
rJMFF046B03- TTAACCTCTAA-GTCCCA
rJMSF029D09- ACATACTCCTTATTAAATACCACCATAAGAACTCTAAATTAACCTCTAA-GTCCCA
                      ____________________________________________________________
consensus AGTAACATACTCCTTATTAAATACCACCATAAGAACTCTAAATTAACCTCTAA-GTCCCA
 
. : . : . : . : . : . :
rJMSF032B15- TATACTTCTTTGGGAGAAGAAAACATTGTTAAATTCTACCAGCAATACAAATGAGATAGC
rJMFF046B03- TATACTTCTTTGGGAGAAGAAAACATTGTTAAATTCTACCAGCAATACAAATGAGATAGC
rJMSF029D09- TATACTTCTTTGGGAGAAGAAAACATTGTTAAATTCTACCAGCAATACAAATGAGATAGC
JMSF032B15+ ATACAAATGAGATAGC
                      ____________________________________________________________
consensus TATACTTCTTTGGGAGAAGAAAACATTGTTAAATTCTACCAGCAATACAAATGAGATAGC
 
. : . : . : . : . : . :
rJMSF032B15- AGCATTCAGAACAGTCTATGGTAGACAGAAGACAATTTTGTTTATCAAGATGAGAAAATG
rJMFF046B03- AGCATTCAGAACAGTCTATGGTAGACAGAAGACAATTTTGTTTATCAAGATGAGAAAATG
rJMSF029D09- AGCATTCAGAACAGTCTATGGTAGACAGAAGACAATTTTGTTTATCAAGATGAGAAAATG
JMSF032B15+ AGCATTCAGAACAGTCTATGGTAGACAGAAGACAATTTTGTTTATCAAGATGAGAAAATG
                      ____________________________________________________________
consensus AGCATTCAGAACAGTCTATGGTAGACAGAAGACAATTTTGTTTATCAAGATGAGAAAATG
 
. : . : . : . : . : . :
rJMSF032B15- AACCAATGAAGCGGAAAATCTTGGAAGGAAAGCATATATATATATATATGTCCTATGAAT
rJMFF046B03- AACCAATGAAGCGGAAAATCTTGGAAGGAAAGCATATATATATATATATGTCCTATGAAT
rJMSF029D09- AACCAATGAAGCGGAAAATCTTGGAAGGAAAGCATATATATATATATATGTCCTATGAAT
JMSF032B15+ AACCAATGAAGCGGAAAATCTNGGAAGGAAAGCATATATATATATATATGTCCTATGAAT
                      ____________________________________________________________
consensus AACCAATGAAGCGGAAAATCTTGGAAGGAAAGCATATATATATATATATGTCCTATGAAT
 
. : . : . : . : . : . :
rJMSF032B15- CCATATTTTCTGCATTTTCATCATCTTCAGATGGCCATATAACAGTTTGAAAGAGGCGCT
rJMFF046B03- CCATATTTTCTGCATTTTCATCATCTTCAGATGGCCATATAACAGTTTGAAAGAGGCGCT
rJMSF029D09- CCATATTTTCTGCATTTTCATCATCTTCAGATGGCCATATAACAGTTTGAAAGAGGCGCT
JMSF032B15+ CCATATTTTCTGCATTTTCATCATCTTCAGATGGCCATATAACAGTTTGAAAGAGGCGCT
JMSF029D09+ ATCTTCAGATGGCCATATAACAGTTTGAAAGAGGCGCT
                      ____________________________________________________________
consensus CCATATTTTCTGCATTTTCATCATCTTCAGATGGCCATATAACAGTTTGAAAGAGGCGCT
 
. : . : . : . : . : . :
rJMSF032B15- CCCGCATCATCTCAACGTTCTCTTTGGAGATTCTTTTGTACATTTCTGCGTGATCACATC
rJMFF046B03- CCCGCATCATCTCAACGTTCTCTTTGGAGATTCTTTTGTACATTTCTGCGTGATCACATC
rJMSF029D09- CCCGCATCATCTCAACGTTCTCTTTGGAGATTCTTTTGTACATTTCTGCGTGATCACATC
JMSF032B15+ CCCGCATCATCTCAACGTTCTCTTTGGAGATTCTTTTGTACATTTCTGCGTGATCACATC
JMSF029D09+ CCCGCATCATCTCAACGTTCTCTTTGGAGATTCTTTTGTACATTTCTGCGTGATCACATC
                      ____________________________________________________________
consensus CCCGCATCATCTCAACGTTCTCTTTGGAGATTCTTTTGTACATTTCTGCGTGATCACATC
 
. : . : . : . : . : . :
rJMSF032B15- TCTTCATCCATATGCTATACAAGTGGAGACGCGTTATCATCACTCTTTCTGCAAGCTCCC
rJMFF046B03- TCTTCATCCATATGCTATACAAGTGGAGACGCGTTATCATCACTC
rJMSF029D09- TCTTCATCCATATGCTATACAAGTGGAGACGCGTTATCATCACTCTTTCTGCAAGCTCCC
JMSF032B15+ TCTTCATCCATATGCTATACAAGTGGAGACGCGTTATCATCACTCTTTCTGCAAGCTCCC
JMSF029D09+ TCTTCATCCATATGCTATACAAGTGGAGACGCGTTATCATCACTCTTTCTGCAAGCTCCC
                      ____________________________________________________________
consensus TCTTCATCCATATGCTATACAAGTGGAGACGCGTTATCATCACTCTTTCTGCAAGCTCCC
 
. : . : . : . : . : . :
rJMSF032B15- GTCTTTCCTTGAAAAGTTCCATGAGAAACCCCTTCCCGGTGTTGGGCCCTTGCGTTGCAA
rJMSF029D09- GTCTTTCCTTGAAAAGTTCCATGAGAAACCCCTTCCCGGTGTTGGGCCCTTGCGTTGCAA
JMSF032B15+ GTCTTTCCTTGAAAAGTTCCATGAGAAACCCCTTCCCGGTGTTGGGCCCTTGCGTTGCAA
JMSF029D09+ GTCTTTCCTTGAAAAGTTCCATGAGAAACCCCTTCCCGGTGTTGGGCCCTTGCGTTGCAA
                      ____________________________________________________________
consensus GTCTTTCCTTGAAAAGTTCCATGAGAAACCCCTTCCCGGTGTTGGGCCCTTGCGTTGCAA
 
. : . : . : . : . : . :
rJMSF032B15- TAAAGTTGTAGAACCACGTGTACTGCGGGGGATTCAGCTCATACAATTGGTGAAGAACGG
rJMSF029D09- TAAAGTTGTAGAACCACGTGTACTGCGGGGGATTCAGCTCATACAATTGGTGAAGAACGG
JMSF032B15+ TAAAGTTGTAGAACCACGTGTACTGCGGGGGATTCAGCTCATACAATTGGTGAAGAACGG
JMSF029D09+ TAAAGTTGTAGAACCACGTGTACTGCGGGGGATTCAGCTCATACAATTGGTGAAGAACGG
JMFF046B03+ TTGTAGAACCACGTGTACTGCGGGGGATTCAGCTCATACAATTGGTGAAGAACGG
JMFF018M09+ TTGTAGAACCACGTGTACTGCGGGGGATTCAGCTCATACAATTGGTGAAGAACGG
                      ____________________________________________________________
consensus TAAAGTTGTAGAACCACGTGTACTGCGGGGGATTCAGCTCATACAATTGGTGAAGAACGG
 
. : . : . : . : . : . :
rJMSF032B15- TTCTTACAGCTTTATATGTCATCACATTCACTATCTCCTCTTTGACATCATTAAAGGAGT
rJMSF029D09- TTCTTACAGCTTTATATGTCATCACATTCACTATCTCCTCTTTGACATCATTAAAGGAGT
JMSF032B15+ TTCTTACAGCTTTATATGTCATCACATTCACTATCTCCTCTTTGACATCATTAAAGGAGT
JMSF029D09+ TTCTTACAGCTTTATATGTCATCACATTCACTATCTCCTCTTTGACATCATTAAAGGAGT
JMFF046B03+ TTCTTACAGCTTTATATGTCATCACATTCACTATCTCCTCTTTGACATCATTAAAGGAGT
JMFF018M09+ TTCTTACAGCTTTATATGTCATCACATTCACTATCTCCTCTTTGACATCATTAAAGGAGT
                      ____________________________________________________________
consensus TTCTTACAGCTTTATATGTCATCACATTCACTATCTCCTCTTTGACATCATTAAAGGAGT
 
. : . : . : . : . : . :
rJMSF032B15- CGTCCGTCTGTCCTTTGAGCTCACCAAAAACAACAAATTTCCTGACTTTCTGCCTCTTTC
rJMSF029D09- CGTCCGTCTGTCCTTTGAGCTCACCAAAAACAACAAATTTCCTGACTTTCTGCCTCTTTC
JMSF032B15+ CGTCCGTCTGTCCTTTGAGCTCACCAAAAACAACAAATTTCCTGACTTTCTGCCTCTTTC
JMSF029D09+ CGTCCGTCTGTCCTTTGAGCTCACCAAAAACAACAAATTTCCTGACTTTCTGCCTCTTTC
JMFF046B03+ CGTCCGTCTGTCCTTTGAGCTCACCAAAAACAACAAATTTCCTGACTTTCTGCCTCTTTC
JMFF018M09+ CGTCCGTCTGTCCTTTGAGCTCACCAAAAACAACAAATTTCCTGACTTTCTGCCTCTTTC
                      ____________________________________________________________
consensus CGTCCGTCTGTCCTTTGAGCTCACCAAAAACAACAAATTTCCTGACTTTCTGCCTCTTTC
 
. : . : . : . : . : . :
rJMSF032B15- TGGAAACCCCATTTGCAGCCCTACTGCCCAGCTTCAACTGCCGCCTTCCCTGCAAGCTTC
rJMSF029D09- TGGAAACCCCATTTGCAGCCCTACTGCCCAGCTTCAACTGCCGCCTTCCCTGCAAGCTTC
JMSF032B15+ TGGAAACCCCATTTGCAGCCCTACTGCCCAGCTTCAACTGCCGCCTTCCCTGCAAGCTTC
JMSF029D09+ TGGAAACCCCATTTGCAGCCCTACTGCCCAGCTTCAACTGCCGCCTTCCCTGCAAGCTTC
JMFF046B03+ TGGAAACCCCATTTGCAGCCCTACTGCCCAGCTTCAACTGCCGCCTTCCCTGCAAGCTTC
JMFF018M09+ TGGAAACCCCATTTGCAGCCCTACTGCCCAGCTTCAACTGCCGCCTTCCCTGCAAGCTTC
                      ____________________________________________________________
consensus TGGAAACCCCATTTGCAGCCCTACTGCCCAGCTTCAACTGCCGCCTTCCCTGCAAGCTTC
 
. : . : . : . : . : . :
rJMSF032B15- TCCAGAAACCCACTTCTCCTCCGC
rJMSF029D09- TCCAGAAACCCACTTCTCCTCCGCGGG
JMSF032B15+ TCCAGAAACCCACTTCTCCTCCGCGGGCCCTGAAACAGAACCTATAAGAATCGCCGCAGT
JMSF029D09+ TCCAGAAACCCACTTCTCCTCCGCGGGCCCTGAAACAGAACCTATAAGAATCGCCGCAGT
JMFF046B03+ TCCAGAAACCCACTTCTCCTCCGCGGGCCCTGAAACAGAACCTATAAGAATCGCCGCAGT
JMFF018M09+ TCCAGAAACCCACTTCTCCTCCGCGGGCCCTGAAACAGAACCTATAAGAATCGCCGCAGT
                      ____________________________________________________________
consensus TCCAGAAACCCACTTCTCCTCCGCGGGCCCTGAAACAGAACCTATAAGAATCGCCGCAGT
 
. : . : . : . : . : . :
JMSF032B15+ TGGGGGGGTTTATGCAGAAACGGGGGGTTGGGTGTTGGGTGTCGGCAATTGAACTTGT
JMSF029D09+ TGGGGGGGTTTATGCAGAAACGGGGGGTTGGGTGTTGGGTGTCGGCAATTGAACTTGTGG
JMFF046B03+ TGGGGGGGTTTATGCAGGAACGGGGGGTTGGGTGTTGGGTGTCGGCAATTGAACTTGTGG
JMFF018M09+ TGGGGGGGTTTATGCAGGAACGGGGGGTTGGGTGTTGGGTGTCGGCAATTGAACTTGTGG
                      ____________________________________________________________
consensus TGGGGGGGTTTATGCAGGAACGGGGGGTTGGGTGTTGGGTGTCGGCAATTGAACTTGTGG
 
. : . : . : . : . : . :
JMSF029D09+ ATACAATAGCTCCAACCATAATGGATTATTGCCCCGGCC
JMFF046B03+ ATACAATAGCTCCAACCATAATGGATTATTGCCCCGGCCGGCCCCCACGATTCTTGAAAT
JMFF018M09+ ATACAATAGCTCCAACCATAATGGATTATTGCCCCGGCCGGCCCCCACGATTCTTGAAAT
                      ____________________________________________________________
consensus ATACAATAGCTCCAACCATAATGGATTATTGCCCCGGCCGGCCCCCACGATTCTTGAAAT
 
. : . : . : . : . : . :
JMFF046B03+ GTCTTGGGATAAAGGAAAGGGGAGTAGCAGTAGAGTATTCTCTTCAGGATTCTGATCCTA
JMFF018M09+ GTCTTGGGATAAAGGAAAGGGGAGTAGCAGTAGAGTATTCTCTTCAGGATTCTGATCCTA
                      ____________________________________________________________
consensus GTCTTGGGATAAAGGAAAGGGGAGTAGCAGTAGAGTATTCTCTTCAGGATTCTGATCCTA
 
. : . : . : . : . : . :
JMFF046B03+ CAGAATTCAGATCAGGCTAAGAACACACCGGGGAAGAATCTTTCTGTTTGTGGATACGGC
JMFF018M09+ CAGAATTCAGATCAGGCTAAGAACACACCGGGGAAGAATCTTTCTGTTTGTGGATACGGC
                      ____________________________________________________________
consensus CAGAATTCAGATCAGGCTAAGAACACACCGGGGAAGAATCTTTCTGTTTGTGGATACGGC