Previous Contig 000953:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018J23Sequence512000953 (3)gb:AP005755_18572755e-23Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN743010147 (4)pir|D84631|D846311e-48probable serine carboxypeptidase II [imported] - Arabidopsis thaliana>gb:AC00517
JMFF036N04Sequence575000953 (3)gb:AP005755_18572753e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN600010147 (4)gb:BT003126_16367072e-41Arabidopsis thaliana At3g63470 mRNA, complete cds.
JMFF041J17Sequence659000953 (3)gb:AP005755_18572751e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN647010147 (4)gb:BT003126_16367077e-45Arabidopsis thaliana At3g63470 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041J17+ ACTTATCATAATCCGAGGAAGTGTTGGAATAAGAGAAACCAACGCCGGCCGGTGACTCC
                      ____________________________________________________________
consensus ACTTATCATAATCCGAGGAAGTGTTGGAATAAGAGAAACCAACGCCGGCCGGTGACTCC
 
. : . : . : . : . : . :
JMFF041J17+ AGAAATAATGTATTTGCAACTCTATTCCATGCAAATCTTCTTGAGTAAAGAGTTTTGGCG
JMFF036N04+ TCCATGCAAATCTTCTTGAGTAAAGAGTTTTGGCG
                      ____________________________________________________________
consensus AGAAATAATGTATTTGCAACTCTATTCCATGCAAATCTTCTTGAGTAAAGAGTTTTGGCG
 
. : . : . : . : . : . :
JMFF041J17+ TCTGGGTTAACGCCGAAAGGTCCAATCTCTACAAAAGCACCCATTCCAAGTGATGAACAC
JMFF036N04+ TCTGGGTTAACGCCGAAAGGTCCAATCTCTACAAAAGCACCCATTCCAAGTGATGAACAC
JMFF018J23+ CTACAAAAGCACCCATTCCAAGTGATGAACAC
                      ____________________________________________________________
consensus TCTGGGTTAACGCCGAAAGGTCCAATCTCTACAAAAGCACCCATTCCAAGTGATGAACAC
 
. : . : . : . : . : . :
JMFF041J17+ CCAGGACCTCCATTAAGCCATAGAATGAGAGGTTTAGTGGCAGAATTCTCAGCAGATTCA
JMFF036N04+ CCAGGACCTCCATTAAGCCATAGAATGAGAGGTTTAGTGGCAGAATTCTCAGCAGATTCA
JMFF018J23+ CCAGGACCTCCATTAAGCCATAGAATGAGAGGTTTAGTGGCAGAATTCTCAGCAGATTCA
                      ____________________________________________________________
consensus CCAGGACCTCCATTAAGCCATAGAATGAGAGGTTTAGTGGCAGAATTCTCAGCAGATTCA
 
. : . : . : . : . : . :
JMFF041J17+ GCAAAGTAATAGAAAAGGCTTCTCCCATTCATCTTATCCACACCCACATACCCTGCGTAC
JMFF036N04+ GCAAAGTAATAGAAAAGGCTTCTCCCATTCATCTTATCCACACCCACATACCCTGCGTAC
JMFF018J23+ GCAAAGTAATAGAAAAGGCTTCTCCCATTCATCTTATCCACACCCACATACCCTGCGTAC
                      ____________________________________________________________
consensus GCAAAGTAATAGAAAAGGCTTCTCCCATTCATCTTATCCACACCCACATACCCTGCGTAC
 
. : . : . : . : . : . :
JMFF041J17+ TGCTTGAACTTCACATTTGACGGCTGTCCCGGAAGCCCGCCGGCGATGAGATCATCCTCC
JMFF036N04+ TGCTTGAACTTCACATTTGACGGCTGTCCCGGAAGCCCGCCGGCGATGAGATCATCCTCC
JMFF018J23+ TGCTTGAACTTCACATTTGACGGCTGTCCCGGAAGCCCGCCGGCGATGAGATCATCCTCC
                      ____________________________________________________________
consensus TGCTTGAACTTCACATTTGACGGCTGTCCCGGAAGCCCGCCGGCGATGAGATCATCCTCC
 
. : . : . : . : . : . :
JMFF041J17+ ATGCTTCCCACCTCGGAAAATGACGACACCATTTCTTCTTCAGTCACTGTGCTCGCTTCT
JMFF036N04+ ATGCTTCCCACCTCGGAAAATGACGACACCATTTCTTCTTCAGTCACTGTGCTCGCTTCT
JMFF018J23+ ATGCTTCCCACCTCGGAAAATGACGACACCATTTCTTCTTCAGTCACTGTGCTCGCTTCT
                      ____________________________________________________________
consensus ATGCTTCCCACCTCGGAAAATGACGACACCATTTCTTCTTCAGTCACTGTGCTCGCTTCT
 
. : . : . : . : . : . :
JMFF041J17+ GCCCATGGCTCGCTATTGACGGAGATCGGCTGAGCGTGCATTTTAGCACGGCGTAAGGAC
JMFF036N04+ GCCCATGGCTCGCTATTGACGGAGATCGGCTGAGCGTGCATTTTAGCACGGCGTAAGGAC
JMFF018J23+ GCCCATGGCTCGCTATTGACGGAGATCGGCTGAGCGTGCATTTTAGCACGGCGTAAGGAC
                      ____________________________________________________________
consensus GCCCATGGCTCGCTATTGACGGAGATCGGCTGAGCGTGCATTTTAGCACGGCGTAAGGAC
 
. : . : . : . : . : . :
JMFF041J17+ AGTAATCCCCGGCCTTGATCAATTTTGCTCAACCCATCCCCAAATCCCGAAAATGTTACC
JMFF036N04+ AGTAATCCCCGGCCTTGATCAATTTTGCTCAACCCATCCCCAAATCCCGAAAATGTTACC
JMFF018J23+ AGTAATCCCCGGCCTTGATCAATTTTGCTCAACCCATCCCCAAATCCCGAAAATGTTACC
                      ____________________________________________________________
consensus AGTAATCCCCGGCCTTGATCAATTTTGCTCAACCCATCCCCAAATCCCGAAAATGTTACC
 
. : . : . : . : . : . :
JMFF041J17+ ATGATAATAAGAAGAGAAAACACATAATGAAATTTCGTGAATAATGAACCATGTTTCTTC
JMFF036N04+ ATGATAATAAGAAGAGAAAACACATAATGAAATTTCGTGAATAATGAACCATGTTTCTTC
JMFF018J23+ ATGATAATAAGAAGAGAAAACACATAATGAAATTTCGTGAATAATGAACCATGTTTCTTC
                      ____________________________________________________________
consensus ATGATAATAAGAAGAGAAAACACATAATGAAATTTCGTGAATAATGAACCATGTTTCTTC
 
. : . : . : . : . : . :
JMFF041J17+ TCCATTGTTAGTTTGTTACTATACGTTGAAGAAGAAAACATACACCAAGGGAAGCGTCA
JMFF036N04+ TCCATTGTTAGTTTGTTACTATACGTTGAAGAAGAAAACATACACCAAGGGAAGCGTCA
JMFF018J23+ TCCATTGTTAGTTTGTTACTATACGTTGAAGAAGAAAACATACACCAAGGGAAGCGTCAC
                      ____________________________________________________________
consensus TCCATTGTTAGTTTGTTACTATACGTTGAAGAAGAAAACATACACCAAGGGAAGCGTCAC