Previous Contig 000950:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009A08Sequence515000950 (25)sp|P00059|CYC_ABUTH4e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute649000950 (25)sp|P00059|CYC_ABUTH8e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFF011H15Sequence538000950 (25)sp|P00059|CYC_ABUTH5e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute640000950 (25)sp|P00059|CYC_ABUTH7e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFF018J07Sequence544000950 (25)sp|P00059|CYC_ABUTH5e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute642000950 (25)sp|P00059|CYC_ABUTH7e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFF026P08Sequence576000950 (25)sp|P00059|CYC_ABUTH6e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute690000950 (25)sp|P00059|CYC_ABUTH9e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFF044L02Sequence651000950 (25)sp|P00059|CYC_ABUTH8e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute588000950 (25)sp|P00059|CYC_ABUTH3e-52Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFF045H16Sequence620000950 (25)sp|P00059|CYC_ABUTH7e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute588000950 (25)sp|P00059|CYC_ABUTH5e-53Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN008B01Sequence625000950 (25)sp|P00059|CYC_ABUTH7e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN013N17Sequence159000950 (25)gb:AF031540_17625741e-10Fritillaria agrestis cytochrome C (cytC) mRNA, complete cds.
JMFN014L20Sequence594000950 (25)sp|P00059|CYC_ABUTH1e-54Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN018D02Sequence625000950 (25)sp|P00059|CYC_ABUTH7e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN019O18Sequence589000950 (25)sp|P00059|CYC_ABUTH6e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN028E08Sequence667000950 (25)sp|P00059|CYC_ABUTH4e-57Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN029I05Sequence590000950 (25)sp|P00059|CYC_ABUTH6e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN029K10Sequence452000950 (25)sp|P00059|CYC_ABUTH3e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN029M12Sequence589000950 (25)sp|P00059|CYC_ABUTH6e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN035F02Sequence493000950 (25)sp|P00059|CYC_ABUTH4e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN037E20Sequence612000950 (25)sp|P00059|CYC_ABUTH7e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN038D23Sequence618000950 (25)sp|P00059|CYC_ABUTH7e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute
JMFN043L19Sequence561000950 (25)sp|P00059|CYC_ABUTH5e-58Cytochrome c.>pir|A00052|CCAB cytochrome c [validated] - China jute

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045H16- ACTTGACGTCTTATTAATGAATTATAATCAGCCTAAA
rJMFF044L02- ACTTGACGTCTTATTAATGAATTATAATCAGCCTAAA
JMFN014L20- ATTGAACTTGACGTCTTATTAATGAATTATAATCAGCCTAAA
JMFN028E08+ ATTAATGAATTATAATCAGCCTAAA
rJMFF009A08- TCTTATTAATGAATTATAATCAGCCTAAA
JMFN018D02+ A
JMFF044L02+ A
rJMFF026P08- ACTTGACGTCTTATTAATGAATTATAATCAGCCTAAA
                      ____________________________________________________________
consensus ATTGAACTTGACGTCTTATTAATGAATTATAATCAGCCTAAA
 
. : . : . : . : . : . :
rJMFF045H16- CAAAAGGGAAGTATGCACTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
rJMFF044L02- CAAAAGGGAAGTATGCACTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
JMFN014L20- CAAAAGGGAAGTATGCACTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
JMFN028E08+ CAAAAGGGAAGTATGCACTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
rJMFF009A08- CAAAAGGGAAGTATGCACTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
JMFN018D02+ CAAAAGGGAAGTATGCACTTCGATGTAT-GAAGTCTAAAAGAATGTCATAGAAGTACAGC
JMFN019O18+ AAAAGAATGTCATAGAAGTACAGC
JMFF044L02+ CAAAAGGGAAGTATGCACTTCGATGTATGAAGTTCTAAAAGAATGTCATAGAAGTACAGC
JMFN037E20+ CTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
JMFN029M12+ GTCTAAAAGAATGTCATAGAAGTACAGC
JMFN008B01+ AGGGAAGTATGCACTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
JMFN029I05+ CTTCGATGTATGAAAGTCTAAAAGAATGTCATAGAAGTACAGC
rJMFF026P08- CAAAAGGGAAGTATGCACTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
JMFN038D23+ CGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
rJMFF011H15- TGCACTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
JMFF045H16+ AAAAGAATGTCATAGAAGTACAGC
rJMFF018J07- CTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
                      ____________________________________________________________
consensus CAAAAGGGAAGTATGCACTTCGATGTATTGAAGTCTAAAAGAATGTCATAGAAGTACAGC
 
. : . : . : . : . : . :
rJMFF045H16- CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
rJMFF044L02- CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFN014L20- CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFN028E08+ CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
rJMFF009A08- CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFN018D02+ CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFN019O18+ CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFF044L02+ CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFN037E20+ CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFN029M12+ CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFN008B01+ CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFN029I05+ CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
rJMFF026P08- CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFN038D23+ CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFF009A08+ TGGG
rJMFF011H15- CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFF045H16+ CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFN043L19+ ACCAGAGTATAGATAAGTAGCAATAAAACCTTATCGGTTGGG
JMFF026P08+ AACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFF011H15+ TTGGG
rJMFF018J07- CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
JMFF018J07+ TTGGG
                      ____________________________________________________________
consensus CACTACTGGCCTATCTCAACCAGAGTATAGATAAGTAGCAATAAAACCTTTACGGTTGGG
 
. : . : . : . : . : . :
rJMFF045H16- TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
rJMFF044L02- TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN014L20- TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN028E08+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
rJMFF009A08- TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN018D02+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN019O18+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFF044L02+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN037E20+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN029M12+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN008B01+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN029I05+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
rJMFF026P08- TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN038D23+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN035F02+ GGCAAGAAAATTGGCATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN029K10+ CCAAAAGAATTGAAAACTGGACGAGT
JMFF009A08+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
rJMFF011H15- TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFF045H16+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFN043L19+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFF026P08+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFF011H15+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
rJMFF018J07- TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
JMFF018J07+ TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
                      ____________________________________________________________
consensus TTCACAATATTATTGGCAAGAAAATTGACATCCACCAAAAGAATTGAAAACTGGACGAGT
 
. : . : . : . : . : . :
rJMFF045H16- GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
rJMFF044L02- GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN014L20- GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN028E08+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
rJMFF009A08- GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN018D02+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN019O18+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFF044L02+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN037E20+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN029M12+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN008B01+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN029I05+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
rJMFF026P08- GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN038D23+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN035F02+ GGTCATTTTTCCAATCATCACTGCTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN029K10+ GGTCATTTTTCCAATCATCAGTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFF009A08+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
rJMFF011H15- GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFF045H16+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFN043L19+ GGTCATTTTTCCAATCATCACTACTCAAAAAAACATCATTCTTCTACAAAATGCATTTCA
JMFF026P08+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFF011H15+ GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
rJMFF018J07- GGCCATTTTTCCAATCATCACCACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
JMFF018J07+ GGCCATTTTTCCAATCATCACCACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
                      ____________________________________________________________
consensus GGTCATTTTTCCAATCATCACTACTCAAAAAATCCTCATTCAACTACAAAATGCATTTCA
 
. : . : . : . : . : . :
rJMFF045H16- GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
rJMFF044L02- GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN014L20- GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN028E08+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
rJMFF009A08- GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN018D02+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN019O18+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFF044L02+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN037E20+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN029M12+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN008B01+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN029I05+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
rJMFF026P08- GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN038D23+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN035F02+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN029K10+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFF009A08+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
rJMFF011H15- GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFF045H16+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFN043L19+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFF026P08+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFF011H15+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
rJMFF018J07- GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
JMFF018J07+ GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
                      ____________________________________________________________
consensus GGCAGTTGATTCCTTGAGATATGCTATGAGATCTGCACGGTCCTGTGGCTTCTTCAATCC
 
. : . : . : . : . : . :
rJMFF045H16- AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
rJMFF044L02- AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN014L20- AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN028E08+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
rJMFF009A08- AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN018D02+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN019O18+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFF044L02+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN037E20+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN029M12+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN008B01+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN029I05+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
rJMFF026P08- AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN038D23+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN035F02+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN029K10+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFF009A08+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
rJMFF011H15- AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFF045H16+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFN043L19+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFF026P08+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFF011H15+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
rJMFF018J07- AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
JMFF018J07+ AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
                      ____________________________________________________________
consensus AGGGAAAACCATCTTGGTTCCAGGAATATACTTCTTGGGGTTAAGCAAGTAGTCATATAG
 
. : . : . : . : . : . :
rJMFF045H16- TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
rJMFF044L02- TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN014L20- TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN028E08+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
rJMFF009A08- TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN018D02+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN019O18+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFF044L02+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN037E20+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN029M12+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN008B01+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN029I05+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
rJMFF026P08- TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN038D23+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN035F02+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN029K10+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFF009A08+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
rJMFF011H15- TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFF045H16+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFN043L19+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFF026P08+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFF011H15+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
rJMFF018J07- TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
JMFF018J07+ TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
                      ____________________________________________________________
consensus TGTGTTCTCTCCCCAGGTGACAGCCATGTTCTTGTTGGCAGCAGAGTAAGAGTAACCTGG
 
. : . : . : . : . : . :
rJMFF045H16- AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
rJMFF044L02- AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN014L20- AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN028E08+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
rJMFF009A08- AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN018D02+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN019O18+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFF044L02+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN037E20+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN029M12+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN008B01+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN029I05+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
rJMFF026P08- AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN038D23+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN035F02+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN029K10+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFF009A08+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
rJMFF011H15- AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFF045H16+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN043L19+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFF026P08+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFN013N17+ GGC
JMFF011H15+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
rJMFF018J07- AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
JMFF018J07+ AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
                      ____________________________________________________________
consensus AGTTGTACCGGATTGTCTGCCGAATAGTCCATTCAAGTTAGGCCCTTGCTTGTGGCCGGC
 
. : . : . : . : . : . :
rJMFF045H16- GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
rJMFF044L02- GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCC
JMFN014L20- GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN028E08+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
rJMFF009A08- GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN018D02+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN019O18+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFF044L02+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN037E20+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN029M12+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN008B01+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN029I05+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
rJMFF026P08- GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN038D23+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN035F02+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN029K10+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFF009A08+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
rJMFF011H15- GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFF045H16+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN043L19+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFF026P08+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFN013N17+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFF011H15+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
rJMFF018J07- GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
JMFF018J07+ GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
                      ____________________________________________________________
consensus GCCTTTGTCAACGGTGTGGCACTGAGCGCACTTCATTTTGAAGATCTTCTCTCCGGATTT
 
. : . : . : . : . : . :
rJMFF045H16- GGCATC
JMFN014L20- GGCATCGCCGGG
JMFN028E08+ GGCATCGCCGGGCGGAGCTTCATTGAAGAAGGCCATGAGTACGAACCAAAAGA-GGATTT
rJMFF009A08- GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN018D02+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN019O18+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFF044L02+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN037E20+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN029M12+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN008B01+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN029I05+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
rJMFF026P08- GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN038D23+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN035F02+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN029K10+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGAGGGATTT
JMFF009A08+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
rJMFF011H15- GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFF045H16+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN043L19+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFF026P08+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFN013N17+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFF011H15+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
rJMFF018J07- GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
JMFF018J07+ GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
                      ____________________________________________________________
consensus GGCATCGCCGGGCGGAGCTTCATTGAAGGAGGCCATGAGTACGAACCAAAAGA-GGATTT
 
. : . : . : . : . : . :
JMFN028E08+ GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCG
rJMFF009A08- GCGGAGTTTGGTATCGGGAGA
JMFN018D02+ GCGGAGTTTGGTATCGGGAGAAACGA
JMFN019O18+ GCGGAGTTTGGTATCGGGAGAAACGA
JMFF044L02+ GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCGGCGAGGGAGTTT
JMFN037E20+ GCGGAGTTTGGTATCGGGAGAAACGAGAAA
JMFN029M12+ GCGGAGTTTGGTATCGGGAGAA
JMFN008B01+ GCGGAGTTTGGTATCGGGAGAAACGAGAAA
JMFN029I05+ GCGGAGTT
rJMFF026P08- GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCGGCGAGGGAGTTTGGT
JMFN038D23+ GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCG
JMFN035F02+ GCGGAGTTTGGTATCGGGAGAAACGAGA
JMFN029K10+ GCGGAG
JMFF009A08+ GCGGAGTTTGGTATCGGGAGAAACGAGAAA
rJMFF011H15- GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCGGCGAGGGAGTTTGGT
JMFF045H16+ GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCGGCGAGGGAGTTTGGT
JMFN043L19+ GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCGG
JMFF026P08+ GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCGGCGAGGGAGTTTGGT
JMFN013N17+ GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAG
JMFF011H15+ GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCGGCGAGGGAGTTTGGT
rJMFF018J07- GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCGGCGAGGGAGTTTGGT
JMFF018J07+ GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCGGCGAGGGAGTTTGGTGAAGAG
                      ____________________________________________________________
consensus GCGGAGTTTGGTATCGGGAGAAACGAGAAACGAAGAGCGGCGAGGGAGTTTGGTGAAGAG