Previous Contig 000942:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007I03Sequence560000942 (6)pir|F85088|F850882e-07hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15822010227 (6)pir|F85088|F850888e-83hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15
JMFF013H12Sequence561000942 (6)pir|F85088|F850881e-07hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15794010227 (6)pir|F85088|F850882e-87hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15
JMFF018G15Sequence576000942 (6)795010227 (6)pir|F85088|F850883e-94hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15
JMFF024P23Sequence483000942 (6)795010227 (6)pir|F85088|F850884e-94hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15
JMFF042I08Sequence652000942 (6)pir|F85088|F850881e-17hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15600010227 (6)pir|F85088|F850884e-55hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15
JMSF017A10Sequence248000942 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042I08+ CAGC
                      ____________________________________________________________
consensus CAGC
 
. : . : . : . : . : . :
JMFF042I08+ AGGGGAACTGGCAATGCCAATGAGATCCTCACCGGTTTTCAGGATAGAACTGTCGGTCTT
                      ____________________________________________________________
consensus AGGGGAACTGGCAATGCCAATGAGATCCTCACCGGTTTTCAGGATAGAACTGTCGGTCTT
 
. : . : . : . : . : . :
JMFF042I08+ AAACGTGGCATTTCCGACCTCGGTGAAAACCCTAGTTAGGGCTCTAGCAGATTCCCAGGG
JMFF013H12+ ACCCTAGTTAGGGCTCTAGCAGATTCCCAGGG
JMFF007I03+ ACCCTAGTTAGGGCTCTAGCAGATTCCCAGGG
                      ____________________________________________________________
consensus AAACGTGGCATTTCCGACCTCGGTGAAAACCCTAGTTAGGGCTCTAGCAGATTCCCAGGG
 
. : . : . : . : . : . :
JMFF042I08+ ATCAGGGGGTTGGTATGTAACCGCAATCATAGTTAAGATTAGCACAGAGAACACAAACAC
JMFF013H12+ ATCAGGGGGTTGGTATGTAACCGCAATCATAGTTAAGATTAGCACAGAGAACACAAACAC
JMFF024P23+ CAATCATAGTTAAGATTAGCACAGAGAACACAAACAC
JMFF007I03+ ATCAGGGGGTTGGTATGTAACCGCAATCATAGTTAAGATTAGCACAGAGAACACAAACAC
JMFF018G15+ AATCATAGTTAAGATTAGCACAGAGAACACAAACAC
                      ____________________________________________________________
consensus ATCAGGGGGTTGGTATGTAACCGCAATCATAGTTAAGATTAGCACAGAGAACACAAACAC
 
. : . : . : . : . : . :
JMFF042I08+ TGAGAAACACACATTGCTTATCTGCTTAATTATGTTTTGCCCAATTGGATCAGTTATTGA
JMFF013H12+ TGAGAAACACACATTGCTTATCTGCTTAATTATGTTTTGCCCAATTGGATCAGTTATTGA
JMFF024P23+ TGAGAAACACACATTGCTTATCTGCTTAATTATGTTTTGCCCAATTGGATCAGTTATTGA
JMFF007I03+ TGAGAAACACACATTGCTTATCTGCTTAATTATGTTTTGCCCAATTGGATCAGTTATTGA
JMFF018G15+ TGAGAAACACACATTGCTTATCTGCTTAATTATGTTTTGCCCAATTGGATCAGTTATTGA
                      ____________________________________________________________
consensus TGAGAAACACACATTGCTTATCTGCTTAATTATGTTTTGCCCAATTGGATCAGTTATTGA
 
. : . : . : . : . : . :
JMFF042I08+ ATTCTGTTCTCTCATTGCAACAAAACCCTACTCAAATCCAAACCATTCACAACACAGATG
JMFF013H12+ ATTCTGTTCTCTCATTGCAACAAAACCCTACTCAAATCCAAACCATTCACAACACAGATG
JMFF024P23+ ATTCTGTTCTCTCATTGCAACAAAACCCTACTCAAATCCAAACCATTCACAACACAGATG
JMFF007I03+ ATTCTGTTCTCTCATTGCAACAAAACCCTACTCAAATCCAAACCATTCACAACACAGATG
JMFF018G15+ ATTCTGTTCTCTCATTGCAACAAAACCCTACTCAAATCCAAACCATTCACAACACAGATG
                      ____________________________________________________________
consensus ATTCTGTTCTCTCATTGCAACAAAACCCTACTCAAATCCAAACCATTCACAACACAGATG
 
. : . : . : . : . : . :
JMFF042I08+ AACACAAACTTTCCAAATTGAAGATTTTGAAGCTAAAGGGTTCACTCACCTCTGATCTGT
JMFF013H12+ AACACAAACTTTCCAAATTGAAGATTTTGAAGCTAAAGGGTTCACTCACCTCTGATCTGT
JMFF024P23+ AACACAAACTTTCCAAATTGAAGATTTTGAAGCTAAAGGGTTCACTCACCTCTGATCTGT
JMFF007I03+ AACACAAACTTTCCAAATTGAAGATTTTGAAGCTAAAGGGTTCACTCACCTCTGATCTGT
JMFF018G15+ AACACAAACTTTCCAAATTGAAGATTTTGAAGCTAAAGGGTTCACTCACCTCTGATCTGT
                      ____________________________________________________________
consensus AACACAAACTTTCCAAATTGAAGATTTTGAAGCTAAAGGGTTCACTCACCTCTGATCTGT
 
. : . : . : . : . : . :
JMFF042I08+ TTACTCCATAGACACCTTTAATCAATGAAAAACTGGATCTTGAAGTTCGACAATGCCTCA
JMFF013H12+ TTACTCCATAGACACCTTTAATCAATGAAAAACTGGATCTTGAAGTTCGACAATGCCTCA
JMFF024P23+ TTACTCCATAGACACCTTTAATCAATGAAAAACTGGATCTTGAAGTTCGACAATGCCTCA
JMSF017A10+ TCCATAGACACCTTTAATCAATGAAAAACTGGATCTTGAAGTTCGACAATGCCTCA
JMFF007I03+ TTACTCCATAGACACCTTTAATCAATGAAAAACTGGATCTTGAAGTTCGACAATGCCTCA
JMFF018G15+ TTACTCCATAGACACCTTTAATCAATGAAAAACTGGATCTTGAAGTTCGACAATGCCTCA
                      ____________________________________________________________
consensus TTACTCCATAGACACCTTTAATCAATGAAAAACTGGATCTTGAAGTTCGACAATGCCTCA
 
. : . : . : . : . : . :
JMFF042I08+ AACTTCAATGGCGGGCTAGCTTTAATCTTCTTTTGTTTTTGAAGGAAACACTGGATCTTG
JMFF013H12+ AACTTCAATGGCGGGCTAGCTTTAATCTTCTTTTGTTTTTGAAGGAAACACTGGATCTTG
JMFF024P23+ AACTTCAATGGCGGGCTAGCTTTAATCTTCTTTTGTTTTTGAAGGAAACACTGGATCTTG
JMSF017A10+ AACTTCAATGGCGGGCTAGCTTTAATCTTCTTTTGTTTTTGAAGGAAACACTGGATCTTG
JMFF007I03+ AACTTCAATGGCGGGCTAGCTTTAATCTTCTTTTGTTTTTGAAGGAAACACTGGATCTTG
JMFF018G15+ AACTTCAATGGCGGGCTAGCTTTAATCTTCTTTTGTTTTTGAAGGAAACACTGGATCTTG
                      ____________________________________________________________
consensus AACTTCAATGGCGGGCTAGCTTTAATCTTCTTTTGTTTTTGAAGGAAACACTGGATCTTG
 
. : . : . : . : . : . :
JMFF042I08+ TAGTTGCGAGTGTGAATAATGACTGAATCTAAACTCAAGAATTCCGTTTATGCGCTCTCT
JMFF013H12+ TAGTTGCGAGTGTGAATAATGACTGAATCTAAACTCAAGAATTCCGTTTATGCGCTCTCT
JMFF024P23+ TAGTTGCGAGTGTGAATAATGACTGAATCTAAACTCAAGAATTCCGTTTATGCGCTCTCT
JMSF017A10+ TAGTTGCGAGTGTGAATAATGACTGAATCTAAACTCAAGAATTCCGTTTATGCGCTCTCT
JMFF007I03+ TAGTTGCGAGTGTGAATAATGACTGAATCTAAACTCAAGAATTCCGTTTATGCGCTCTCT
JMFF018G15+ TAGTTGCGAGTGTGAATAATGACTGAATATAAACTCAGGAATTCCGTTTATGCGCTCTCT
                      ____________________________________________________________
consensus TAGTTGCGAGTGTGAATAATGACTGAATCTAAACTCAAGAATTCCGTTTATGCGCTCTCT
 
. : . : . : . : . : . :
JMFF042I08+ CTCCAGAAGTTCTTGGAAGAAGAATTGGGTTGTGAAGAAAGCTTGGATCTTGAAGATGGT
JMFF013H12+ CTCCAGAAGTTCTTGGAAGAAGAATTGGGTTGTGAAGAAAGCTTGGATCTTGAAGATGGT
JMFF024P23+ CTCCAGAAGTTCTTGGAAGAAGAATTGGGTTGTGAAGAAAGCTTGGATCTTGAAGATGGT
JMSF017A10+ CTCCAGAAGTTCTTGGAAGAAGAATTGGGTTGTGAAGAAAGCTTGGATCTTGAAGATGGT
JMFF007I03+ CTCCAGAAGTTCTTGGAAGAAGAATTGGGTTGTGAAGAAAGCTTGGATCTTGAAGATGGT
JMFF018G15+ CTCCAGAAGTTCTTGGAAGAAGAATTGGGTTGTGAAGAAAGCTTGGATCTTGAAGATGGT
                      ____________________________________________________________
consensus CTCCAGAAGTTCTTGGAAGAAGAATTGGGTTGTGAAGAAAGCTTGGATCTTGAAGATGGT
 
. : . : . : . : . : . :
JMFF042I08+ TTCCAGAATCTGGGTACTATAGCGCTAAAGGAGGGTATGTCTGTATGT
JMFF013H12+ TTCCAGAATCTGGGTACTATAGCGCTAAAGGAGGGTATGTCTGTATGT
JMFF024P23+ TTCCAGAATCTGGGTACTATAACGCT
JMSF017A10+ TTCCAGAATCT
JMFF007I03+ TTCCAGAATCTGGGTACTATAGCGCTAAAGGAGGGTATGTCTGTATGT
JMFF018G15+ TTCCAGAATCTGGGTACTATAGCGCTAAAGGAGGGTATGTCTGTATGTATAATGTATGTA
                      ____________________________________________________________
consensus TTCCAGAATCTGGGTACTATAGCGCTAAAGGAGGGTATGTCTGTATGTATAATGTATGTA
 
. : . : . : . : . : . :
JMFF018G15+ TCATGCATTGATTAGATTTGAAGGAAGCTATAGAATATGGAGGAAAATAGAGACAGATCT
                      ____________________________________________________________
consensus TCATGCATTGATTAGATTTGAAGGAAGCTATAGAATATGGAGGAAAATAGAGACAGATCT