Previous Contig 000939:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018G06Sequence622000939 (16)gb:AY603422_16174572e-48Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase745002836 (8)gb:AY603422_16174572e-64Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS011B03Sequence610000939 (16)gb:AY603422_16174579e-52Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS023D09Sequence593000939 (16)gb:AY603422_16174578e-56Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS070E10Sequence621000939 (16)gb:AY603422_16174572e-70Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS093E04Sequence598000939 (16)gb:AY603422_16174572e-67Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS096A12Sequence621000939 (16)gb:AY603422_16174573e-82Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS105D05Sequence609000939 (16)gb:AY603422_16174574e-61Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS108C04Sequence609000939 (16)gb:AY603422_16174576e-51Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS111H09Sequence614000939 (16)gb:AY603422_16174572e-55Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS126A09Sequence616000939 (16)gb:AY603422_16174576e-61Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS130E03Sequence619000939 (16)gb:AY603422_16174572e-50Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS133E06Sequence564000939 (16)gb:AY603422_16174572e-74Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS150E06Sequence520000939 (16)gb:AY603422_16174571e-53Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMFS155A08Sequence617000939 (16)gb:AY603422_16174574e-51Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMSF017H01Sequence229000939 (16)786002836 (8)gb:AY603422_16174576e-61Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase
JMSF050A19Sequence600000939 (16)gb:AY603422_16174576e-38Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase329002836 (8)gb:AY603422_16174572e-14Pyrus pyrifolia isolate Kousui2 leucine-rich repeat receptor-like protein kinase

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS096A12+ GTAACTCATATAGATTCGGGGAATTTGCAATGCTC
                      ____________________________________________________________
consensus GTAACTCATATAGATTCGGGGAATTTGCAATGCTC
 
. : . : . : . : . : . :
JMFS096A12+ TCCGGTAACTCACCTTCTAATTGGTTCTCATAGAGATTGAGTGACTCGAGCGGCAACTCG
                      ____________________________________________________________
consensus TCCGGTAACTCACCTTCTAATTGGTTCTCATAGAGATTGAGTGACTCGAGCGGCAACTCG
 
. : . : . : . : . : . :
JMFS096A12+ CATAGCTCATTAGGAATGGTTCCGGCCAACTGGTTCATGGACACGTCGATACGTCTCAGC
                      ____________________________________________________________
consensus CATAGCTCATTAGGAATGGTTCCGGCCAACTGGTTCATGGACACGTCGATACGTCTCAGC
 
. : . : . : . : . : . :
JMFS096A12+ GCCGTCATCTTCGACCACCCCGTCGCCGGAAGTTCTCCCGTAAACGAGTTATTGTAGAGT
                      ____________________________________________________________
consensus GCCGTCATCTTCGACCACCCCGTCGCCGGAAGTTCTCCCGTAAACGAGTTATTGTAGAGT
 
. : . : . : . : . : . :
JMFS096A12+ TCAATTTGCTGGGCGCTGGTTAACTCGGTGAGCCAAATCGGAACAGGGCCGGTCAACTTG
                      ____________________________________________________________
consensus TCAATTTGCTGGGCGCTGGTTAACTCGGTGAGCCAAATCGGAACAGGGCCGGTCAACTTG
 
. : . : . : . : . : . :
JMFS096A12+ TTCGAAGCCACGTCGAAATCAACGAGCTTGGTGAGCCGACTCAACGAGTCAGGAATCTCC
JMFS133E06+ AGCCACGTCGAAATCAACGAGCTTGGTGAGCCGACTCAACGAGTCAGGAATCTCC
                      ____________________________________________________________
consensus TTCGAAGCCACGTCGAAATCAACGAGCTTGGTGAGCCGACTCAACGAGTCAGGAATCTCC
 
. : . : . : . : . : . :
JMFS096A12+ CCGATTAAGTTGCACTCTGTGAGCCAGAAGTACTCGAGATTCGTGAGGTTTCCGAGCTCA
JMFS133E06+ CCGATTAAGTTGCACTCTGTGAGCCAGAAGTACTCGAGATTCGTGAGGTTTCCGAGCTCA
                      ____________________________________________________________
consensus CCGATTAAGTTGCACTCTGTGAGCCAGAAGTACTCGAGATTCGTGAGGTTTCCGAGCTCA
 
. : . : . : . : . : . :
JMFS096A12+ GGCGGGATCCGACCCGGCGAAAACTGGTTGTATGACAGATTCAGCTGTTTCAGACTCGAA
JMFS133E06+ GGCGGGATCCGACCCGGCGAAAACTGGTTGTATGACAGATTCAGCTGTTTCAGACTCGAA
JMFS126A09+ GGCGGGATCCGACCCGGCGAAAACTGGTTGTATGACAGATTCAGCTGTTTAAGACTCGAA
JMFS093E04+ CTGGTTGTATGACAGATTCAGCTGTTTCAGACTCGAA
JMFS070E10+ GATCCGACCCGGCGAAAACTGGTTGTATGACAGATTCAGCTGTTTCAGACTCGAA
                      ____________________________________________________________
consensus GGCGGGATCCGACCCGGCGAAAACTGGTTGTATGACAGATTCAGCTGTTTCAGACTCGAA
 
. : . : . : . : . : . :
JMFS096A12+ ATGTTCCCGAGAAAAGCCGGAATAGTACCTTGAATCAAATTCTGAACCAGCCCCAGCACC
JMFS133E06+ ATGTTCCCGAGAAAAGCCGGAATAGTACCTTGAATCAAATTCTGAACCAGCCCCAGCACC
JMFS126A09+ ATGTTCCCGAG-AAAGCCGGAATAGTACCTTGAATCAAATTCTGAACCAGCCCCAGCACC
JMFS093E04+ ATGTTCCCGAGAAAAGCCGGAATAGTACCTTGAATCAAATTCTGAACCAGCCCCAGCACC
JMFS070E10+ ATGTTCCCGAGAAAAGCCGGAATAGTACCTTGAATCAAATTCTGAACCAGCCCCAGCACC
JMFS105D05+ CCCGAGAAAAGCCGGAATAGTACCTTGAATCAAATTCTGAACCAGCCCCAGCACC
JMFS150E06+ ACCAGCCCCAGCACC
JMFS023D09+ GAACCAGCCCCAGCACC
JMFS111H09+ ACCAGCCCCAGCACC
                      ____________________________________________________________
consensus ATGTTCCCGAGAAAAGCCGGAATAGTACCTTGAATCAAATTCTGAACCAGCCCCAGCACC
 
. : . : . : . : . : . :
JMFS096A12+ TCAAGTTTCTGGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS133E06+ TCAAGTTTCTGGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS126A09+ TCAAGTTTCTGGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS093E04+ TCAAGTTTCTGGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS070E10+ TCAAGTTTCTGGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS105D05+ TCAAGTTTCTGGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS150E06+ TC-AGTTTCTGGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS023D09+ TCAAGTTTCTGGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS111H09+ TCAAGTTTCTGGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS108C04+ GGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCNCCGTC
JMFS011B03+ GGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS155A08+ ACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
JMFS130E03+ CGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCNCCGTC
JMSF050A19+ GTC
JMFF018G06+ GCCGGAAAAATTGTTCCCCGTC
                      ____________________________________________________________
consensus TCAAGTTTCTGGAACGACCCGAAGCTCGCCGGAATGTCGCCGGAAAAATTGTTCCCCGTC
 
. : . : . : . : . : . :
JMFS096A12+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAA
JMFS133E06+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS126A09+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS093E04+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS070E10+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS105D05+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS150E06+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS023D09+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS111H09+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS108C04+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS011B03+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS155A08+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFS130E03+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMSF050A19+ AGGTCAAGATATTTCAAGTTGGGCAGNTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
JMFF018G06+ AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
                      ____________________________________________________________
consensus AGGTCAAGATATTTCAAGTTGGGCAGCTCAGGCAAGCTCGCCGGAAGCGACCCAGTCAAG
 
. : . : . : . : . : . :
JMFS133E06+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS126A09+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS093E04+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS070E10+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS105D05+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS150E06+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS023D09+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS111H09+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS108C04+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS011B03+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS155A08+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFS130E03+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMSF050A19+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
JMFF018G06+ TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
                      ____________________________________________________________
consensus TAATTCTGAGCCAAATCCAGGTGCTCCAAGGCCTCACAAGCCGACAACCCATCAGGAAGA
 
. : . : . : . : . : . :
JMFS133E06+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS126A09+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS093E04+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS070E10+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS105D05+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS150E06+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS023D09+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS111H09+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS108C04+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS011B03+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS155A08+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFS130E03+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMSF050A19+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
JMFF018G06+ GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
                      ____________________________________________________________
consensus GTCGAACCTATCGAGTTATTATACAACGAAATAAACCTCAAATTCTTAAGCCGGCAAAGA
 
. : . : . : . : . : . :
JMFS133E06+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS126A09+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS093E04+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS070E10+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS105D05+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS150E06+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS023D09+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS111H09+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS108C04+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS011B03+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS155A08+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFS130E03+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMSF050A19+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
JMFF018G06+ ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
                      ____________________________________________________________
consensus ACCACCGGAAAAGGCCCAGCAATGTTAGCATTAGAAAGCTCCAGTCTTGTCACAGACCCA
 
. : . : . : . : . : . :
JMFS133E06+ GACCCCAAGTCACACCCAACACCAAACCA
JMFS126A09+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFS093E04+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFS070E10+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFS105D05+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFS150E06+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFS023D09+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFS111H09+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFS108C04+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFS011B03+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFS155A08+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFS130E03+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMSF050A19+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
JMFF018G06+ GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
                      ____________________________________________________________
consensus GACCCCAAGTCACACCCAACACCAAACCACTGACACGGCGAGTTGTCCCGGTCATTCCAG
 
. : . : . : . : . : . :
JMFS126A09+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFS093E04+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFS070E10+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFS105D05+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFS150E06+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFS023D09+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFS111H09+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFS108C04+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFS011B03+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFS155A08+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFS130E03+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMSF050A19+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
JMFF018G06+ CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
                      ____________________________________________________________
consensus CCCGAAAGCACGCCGTCCGGGTCGTCCAACCCGAGCTTCGCTCTGTGCAGGTAAAGAACT
 
. : . : . : . : . : . :
JMFS126A09+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFS093E04+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFS070E10+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFS105D05+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFS150E06+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFS023D09+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFS111H09+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFS108C04+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFS011B03+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFS155A08+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFS130E03+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMSF050A19+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMSF017H01+ GAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
JMFF018G06+ TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
                      ____________________________________________________________
consensus TCTTGGTTGAGCGAGAAAACGAAGCTGGGGAAGACGAGAAAAGCAACAAAGATTTGGAAA
 
. : . : . : . : . : . :
JMFS126A09+ AGCATTTCGATTTT
JMFS093E04+ AGCATTTCGATTTTTCGAAAG
JMFS070E10+ AGCATTTCGATTTTTCGAAAGCTTGT
JMFS105D05+ AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
JMFS150E06+ AGCATTTCGATTTTTCGAAAGCTTGT
JMFS023D09+ AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
JMFS111H09+ AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
JMFS108C04+ AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
JMFS011B03+ AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
JMFS155A08+ AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
JMFS130E03+ AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
JMSF050A19+ AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
JMSF017H01+ AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
JMFF018G06+ AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
                      ____________________________________________________________
consensus AGCATTTCGATTTTTCGAAAGCTTGTGCCTTTAGAGAAGAATGAGAGTTAGTAGCAGCAG
 
. : . : . : . : . : . :
JMFS105D05+ AAAAAGAAGGTGCT
JMFS023D09+ AAAAAGAAGGTGCTTTTATGTCCTTGATGATGCGAA
JMFS111H09+ AAAAAGAAGGTGCTTTTATGTCCTTGATGATGCGAAGAAGAAGAAGAAGAAAAGATGAA
JMFS108C04+ AAAAAGAAGGTGCTTTTATGTCCTTGATGATGCGAAGAAGAAGAAGAAGAAAAGATGAAC
JMFS011B03+ AAAAAGAAGGTGCTTTTATGTCCTTGATGATGCGAAGAAGAAGAAGAAGAAAAGATGAAC
JMFS155A08+ AAAAAGAAGGTGCTTTTATGTCCTTGATGATGCGAAGAAGAAGAAGAAGAAAAGATGAAC
JMFS130E03+ AAAAAGAAGGTGCTTTTATGTCCTTGATGATGCGAAGAAGAAGAAGAAGAAAAGATGAAC
JMSF050A19+ AAAAAGAAGGTGCTTTTATGTCCTTGATGATGCGAAGAAGAAGAAGAAGAAAAGATGAAC
JMSF017H01+ AAAAAGAAGGTGCTTTTATGTCCTTGATGATGCGAAGAAGAAGAAGAAGAAAAGATGAAC
JMFF018G06+ AAAAAGAAGGTGCTTTTATGTCCTTGATGATGCGAAGAAGAAGAAGAAGAAAAGATGAAC
                      ____________________________________________________________
consensus AAAAAGAAGGTGCTTTTATGTCCTTGATGATGCGAAGAAGAAGAAGAAGAAAAGATGAAC
 
. : . : . : . : . : . :
JMFS108C04+ ATGAGAAAAATATTGTTTC
JMFS011B03+ ATGAGAAAAATATTGTTTCC
JMFS155A08+ ATGAGAAAAATATTGTTTCCGCTTATAAAATCT
JMFS130E03+ ATGAGAAAAATATTGTTTCCGCTTATAAAATCT
JMSF050A19+ ATGAGAAAAATATTGTTTCCGCTTATAAAATCTAAAAAGGCAGTGATTGATCT
JMSF017H01+ ATGAGAAAAATATTGTTTCCGCTTATAAAATCTAAAAAGGCAGTGATTGATCT
JMFF018G06+ ATGAGAAAAATATTGTTTCCGCTTATAAAATCTAAAAAGGCAGTGATTGATCTGATATCT
                      ____________________________________________________________
consensus ATGAGAAAAATATTGTTTCCGCTTATAAAATCTAAAAAGGCAGTGATTGATCTGATATCT