Previous Contig 000938:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004J24Sequence629000938 (13)sp|P24922|IF52_NICPL5e-86Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210661000938 (13)sp|P24922|IF52_NICPL5e-86Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210
JMFF018F20Sequence557000938 (13)sp|P24922|IF52_NICPL6e-83Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210703000938 (13)sp|P24922|IF52_NICPL6e-86Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210
JMFF035D11Sequence662000938 (13)sp|P24922|IF52_NICPL2e-85Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210692000938 (13)sp|P24922|IF52_NICPL2e-85Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210
JMFF046D19Sequence504000938 (13)sp|P24922|IF52_NICPL2e-76Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210409000938 (13)gb:AF516353_18074955e-27Hevea brasiliensis eukaryotic translation initiation factor 5A isoform IV (eIF-5
JMFN015I09Sequence613000938 (13)sp|P24922|IF52_NICPL4e-86Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210
JMFN016E05Sequence627000938 (13)sp|P24922|IF52_NICPL5e-86Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210
JMFN029M04Sequence643000938 (13)sp|P24922|IF52_NICPL5e-86Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210
JMFN030N17Sequence620000938 (13)sp|P24922|IF52_NICPL5e-86Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210
JMFN036M13Sequence644000938 (13)sp|P24922|IF52_NICPL5e-86Eukaryotic translation initiation factor 5A-2 (eIF-5A) (eIF-4D).>pir|S21059|S210

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046D19- ACCCTGGAGAGXXXXX
                      ____________________________________________________________
consensus ACCCTGGAGAGNNNNN
 
. : . : . : . : . : . :
rJMFF046D19- XXXXXXXXXXXXXXXXXXGAGAAAAAACACCACCAGGTAAATATAGGATTGTATGTCTAA
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNGAGAAAAAACACCACCAGGTAAATATAGGATTGTATGTCTAA
 
. : . : . : . : . : . :
rJMFF046D19- ACTTTCAATATATATATCACGAAACAGAGTTCAAAACTATGACTAAAGCAACAATAGTGC
JMFN029M04+ CACGAAACAGAGTTCAAAACTATGACTAAAGCAACAATAGTGC
rJMFF004J24- CACGAAACAGAGTTCAAAACTATGACTAAAGCAACAATAGTGC
rJMFF035D11- CACGAAACAGAGTTCAAAACTATGACTAAAGCAACAATAGTGC
JMFF035D11+ GCAACAATAGTGC
JMFN036M13+ GCAACAATAGTGC
JMFF004J24+ CTAAAGCAACAATAGTGC
rJMFF018F20- CACGAAACAGAGTTCAAAACTATGACTAAAGCAACAATAGTGC
                      ____________________________________________________________
consensus ACTTTCAATATATATATCACGAAACAGAGTTCAAAACTATGACTAAAGCAACAATAGTGC
 
. : . : . : . : . : . :
rJMFF046D19- AATACAGCCAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
JMFN029M04+ AATACAGCCAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
rJMFF004J24- AATACAGCCAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
rJMFF035D11- AATACAGCCAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
JMFF035D11+ AATACAGCCAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
JMFN036M13+ AATACAGCCAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
JMFF004J24+ AATACAGCCAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
JMFN030N17+ TGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
JMFN016E05+ AGCCAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
JMFN015I09+ CAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
rJMFF018F20- AATACAGCCAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
                      ____________________________________________________________
consensus AATACAGCCAATGATCCAGAAATGTTCAACGATCCACGCATGCATCAAAGCAAGCATTAA
 
. : . : . : . : . : . :
rJMFF046D19- GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
JMFN029M04+ GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
rJMFF004J24- GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
rJMFF035D11- GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
JMFF035D11+ GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
JMFN036M13+ GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
JMFF004J24+ GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
JMFN030N17+ GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
JMFN016E05+ GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
JMFN015I09+ GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
rJMFF018F20- GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
JMFF018F20+ CCTTGAGAGCACAGATC
                      ____________________________________________________________
consensus GATGTAAATACTCGCTACTTATCTTAGTTCTTTGGGCCTATGTCCTTGAGAGCACAGATC
 
. : . : . : . : . : . :
rJMFF046D19- TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
JMFN029M04+ TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
rJMFF004J24- TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
rJMFF035D11- TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
JMFF035D11+ TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
JMFN036M13+ TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
JMFF004J24+ TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
JMFN030N17+ TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
JMFN016E05+ TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
JMFN015I09+ TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
rJMFF018F20- TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
JMFF046D19+ CAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
JMFF018F20+ TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
                      ____________________________________________________________
consensus TGTTCCTCCCCCATTGCAGACATGACCGATACAACAAGATCTTTTCCTTCACCAAATCCG
 
. : . : . : . : . : . :
rJMFF046D19- TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
JMFN029M04+ TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
rJMFF004J24- TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
rJMFF035D11- TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
JMFF035D11+ TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
JMFN036M13+ TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
JMFF004J24+ TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
JMFN030N17+ TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
JMFN016E05+ TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
JMFN015I09+ TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
rJMFF018F20- TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
JMFF046D19+ TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
JMFF018F20+ TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
                      ____________________________________________________________
consensus TCCTTAATCTGAGTTAAGAGATTTTCATCTGTCGGAAGCCTTAAATCATCCTTGGTGTTG
 
. : . : . : . : . : . :
rJMFF046D19- CCACTCTCAGTCAGAAGGCTCACAAAACCATCC
JMFN029M04+ CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
rJMFF004J24- CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
rJMFF035D11- CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
JMFF035D11+ CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
JMFN036M13+ CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
JMFF004J24+ CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
JMFN030N17+ CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
JMFN016E05+ CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
JMFN015I09+ CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
rJMFF018F20- CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
JMFF046D19+ CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
JMFF018F20+ CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
                      ____________________________________________________________
consensus CCACTCTCAGTCAGAAGGCTCACAAAACCATCCTCAGAAATATCAATCAGCTGATAGTCA
 
. : . : . : . : . : . :
JMFN029M04+ GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
rJMFF004J24- GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
rJMFF035D11- GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
JMFF035D11+ GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
JMFN036M13+ GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
JMFF004J24+ GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
JMFN030N17+ GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
JMFN016E05+ GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
JMFN015I09+ GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
rJMFF018F20- GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
JMFF046D19+ GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
JMFF018F20+ GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
                      ____________________________________________________________
consensus GTACGGTTAACATGAGGAACATCACAGTTATGAGATGATGGGACAATATCCTCAAGCTTC
 
. : . : . : . : . : . :
JMFN029M04+ TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
rJMFF004J24- TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
rJMFF035D11- TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
JMFF035D11+ TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
JMFN036M13+ TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
JMFF004J24+ TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
JMFN030N17+ TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
JMFN016E05+ TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
JMFN015I09+ TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
rJMFF018F20- TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
JMFF046D19+ TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
JMFF018F20+ TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
                      ____________________________________________________________
consensus TTGCCAGTGAAGATATCAATTGCAACAAAATGACACTTGGCATGTCCATGCTTCCCTGTT
 
. : . : . : . : . : . :
JMFN029M04+ TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
rJMFF004J24- TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
rJMFF035D11- TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTCCTTGATGACGATGTGACCATTC
JMFF035D11+ TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTCCTTGATGACGATGTGACCATTC
JMFN036M13+ TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
JMFF004J24+ TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
JMFN030N17+ TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
JMFN016E05+ TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
JMFN015I09+ TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
rJMFF018F20- TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
JMFF046D19+ TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
JMFF018F20+ TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
                      ____________________________________________________________
consensus TTGGAGGTAGAGACCTCAACAACTTTGCAAGGGCGGTTCTTGATGACGATGTGACCATTC
 
. : . : . : . : . : . :
JMFN029M04+ TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
rJMFF004J24- TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
rJMFF035D11- TTGCGAAAGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
JMFF035D11+ TTGCGAAAGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
JMFN036M13+ TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
JMFF004J24+ TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
JMFN030N17+ TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
JMFN016E05+ TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
JMFN015I09+ TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
rJMFF018F20- TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
JMFF046D19+ TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
JMFF018F20+ TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
                      ____________________________________________________________
consensus TTGCGAATGGTACCAGCTTGTTGGGGATAGGTTTTGGAGGCGCCGGCATCGGCCTTGGAC
 
. : . : . : . : . : . :
JMFN029M04+ TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGA
rJMFF004J24- TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
rJMFF035D11- TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
JMFF035D11+ TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
JMFN036M13+ TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTTTTTTCGGAT
JMFF004J24+ TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
JMFN030N17+ TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
JMFN016E05+ TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
JMFN015I09+ TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
rJMFF018F20- TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
JMFF046D19+ TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
JMFF018F20+ TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
                      ____________________________________________________________
consensus TCAAACTGATGCTCCTCGTCCGACATCGCTCCTCTTCTTTCCTTTCTTTTCTTTTCGGAT
 
. : . : . : . : . : . :
rJMFF004J24- TGTTCTCTTC
rJMFF035D11- TTTTCTCTTCACTGCAAATGAGTCCTCAGAGCAGCAACCGAAAAAGGGG
JMFF035D11+ TTTTCTCTTCACTGCAAATGAGTCCTCAGAGCAGCAACCGAAAAAGGGG
JMFN036M13+ TTTTCTCTTCACTGCAAATGAGTCCTCAGAG
JMFF004J24+ TGTTCTCTTC
JMFN030N17+ TTTTCTCTTCACTGCAAATGAGTCCTCAGAG
JMFN016E05+ TTTTCTCTTCACTGCAAATGAGTCCTCAGAGC
JMFN015I09+ TTTTCTCTTCACTGCAAATGA
rJMFF018F20- TTTTCTCTTCACTGCAAATGAGTCCTCAGAGCAGCAACCGAAAAAGGGGAGAAGAAACGT
JMFF046D19+ TTTTCTCTTCACTGCAAATGAGTCCTCAGAGCAGCAACCG
JMFF018F20+ TTTTCTCTTCACTGCAAATGAGTCCTCAGAGCAGCAACCGAAAAAGGGGAGAAGAAACGT
                      ____________________________________________________________
consensus TTTTCTCTTCACTGCAAATGAGTCCTCAGAGCAGCAACCGAAAAAGGGGAGAAGAAACGT