Previous Contig 000929:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018B22Sequence549000929 (6)sp|P42553|S1FA_ORYSA1e-04DNA binding protein S1FA.>gb:OSJN00286_1191043 Oryza sativa (japonica cultivar-g562000929 (6)sp|P42553|S1FA_ORYSA1e-04DNA binding protein S1FA.>gb:OSJN00286_1191043 Oryza sativa (japonica cultivar-g
JMFN045D11Sequence561000929 (6)sp|P42553|S1FA_ORYSA1e-04DNA binding protein S1FA.>gb:OSJN00286_1191043 Oryza sativa (japonica cultivar-g
JMFS039A02Sequence544000929 (6)sp|P42553|S1FA_ORYSA1e-04DNA binding protein S1FA.>gb:OSJN00286_1191043 Oryza sativa (japonica cultivar-g
JMSF042G16Sequence560000929 (6)sp|P42553|S1FA_ORYSA1e-04DNA binding protein S1FA.>gb:OSJN00286_1191043 Oryza sativa (japonica cultivar-g516000929 (6)sp|P42553|S1FA_ORYSA1e-04DNA binding protein S1FA.>gb:OSJN00286_1191043 Oryza sativa (japonica cultivar-g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN045D11+ AATCGAAGTGACACA
                      ____________________________________________________________
consensus AATCGAAGTGACACA
 
. : . : . : . : . : . :
JMSF042G16+ TTCAGAAATCAAAAGAGATTTATTCCACCTACCCATATCTTGCTTTTCTT
rJMSF042G16- ATCTTGCTTTTCTT
JMFN045D11+ TCACTACAAATTCAGAAATCAAAAGAGATTTATTCCACCTACCCATATCTTGCTTTTCTT
JMFS039A02+ TTCAGAAATCAAAAGAGATTTATTCCACCTACCCATATCTTGCTTTTCTT
rJMFF018B22- ACCTACCCATATCTTGCTTTTCTT
JMFF018B22+ TGCTTTTCTT
                      ____________________________________________________________
consensus TCACTACAAATTCAGAAATCAAAAGAGATTTATTCCACCTACCCATATCTTGCTTTTCTT
 
. : . : . : . : . : . :
JMSF042G16+ TCACTTTTTGCAGTGATATCACAGGTAGATGAGGTTGAGGGGATATTATTGTTCATTGCA
rJMSF042G16- TCACTTTTTGCAGTGATATCACAGGTAGATGAGGTTGAGGGGATATTATTGTTCATTGCA
JMFN045D11+ TCACTTTTTGCAGTGATATCACAGGTAGATGAGGTTGAGGGGATATTATTGTTCATTGCA
JMFS039A02+ TCACTTTTTGCAGTGATATCACAGGTAGATGAGGTTGAGGGGATATTATTGTTCATTGCA
rJMFF018B22- TCACTTTTTGCAGTGATATCACAGGTAGATGAGGTTGAGGGGATATTATTGTTCATTGCA
JMFF018B22+ TCACTTTTTGCAGTGATATCACAGGTAGATGAGGTTGAGGGGATATTATTGTTCATTGCA
                      ____________________________________________________________
consensus TCACTTTTTGCAGTGATATCACAGGTAGATGAGGTTGAGGGGATATTATTGTTCATTGCA
 
. : . : . : . : . : . :
JMSF042G16+ AACCCCAA-CCATCTCTCTACTTATTTTCTTCACATTGCTAATCAAGTCTCAAACTGAAG
rJMSF042G16- AACCCCAA-CCATCTCTCTACTTATTTTCTTCACATTGCTAATCAAGTCTCAAACTGAAG
JMFN045D11+ AACCCCAA-CCATCTCTCTACTTATTTTCTTCACATTGCTAATCAAGTCTCAAACTGAAG
JMFS039A02+ AACCCCAA-CCATCTCTCTACTTATTTTCTTCACATTGCTAATCAAGTCTCAAACTGAAG
rJMFF018B22- AACCCCAA-CCATCTCTCTACTTATTTTCTTCACATTGCTAATCAAGTCTCAAACTGAAG
JMFF018B22+ AACCCCAACCCATCTCTCTACTTATTTTCTTCACATTGCTAATCAAGTCTCAAACTGAAG
                      ____________________________________________________________
consensus AACCCCAA-CCATCTCTCTACTTATTTTCTTCACATTGCTAATCAAGTCTCAAACTGAAG
 
. : . : . : . : . : . :
JMSF042G16+ CAAACTACATGAACTGAAAATAGAACAAAATTAACAAACTCATATAGGAACTTGGAGCCC
rJMSF042G16- CAAACTACATGAACTGAAAATAGAACAAAATTAACAAACTCATATAGGAACTTGGAGCCC
JMFN045D11+ CAAACTACATGAACTGAAAATAGAACAAAATTAACAAACTCATATAGGAACTTGGAGCCC
JMFS039A02+ CAAACTACATGAACTGAAAATAGAACAAAATTAACAAACTCATATAGGAACTTGGAGCCC
rJMFF018B22- CAAACTACATGAACTGAAAATAGAACAAAATTAACAAACTCATATAGGAACTTGGAGCCC
JMFF018B22+ CAAACTACATGAACTGAAAATAGAACAAAATTAACAAACTCATATAGGAACTTGGAGCCC
                      ____________________________________________________________
consensus CAAACTACATGAACTGAAAATAGAACAAAATTAACAAACTCATATAGGAACTTGGAGCCC
 
. : . : . : . : . : . :
JMSF042G16+ TCTAGATGGGTGTCCATTGATGGATGATCTATTCTCCCGGTGCTGAGACACCTTGCTTCA
rJMSF042G16- TCTAGATGGGTGTCCATTGATGGATGATCTATTCTCCCGGTGCTGAGACACCTTGCTTCA
JMFN045D11+ TCTAGATGGGTGTCCATTGATGGATGATCTATTCTCCCGGTGCTGAGACACCTTGCTTCA
JMFS039A02+ TCTAGATGGGTGTCCATTGATGGATGATCTATTCTCCCGGTGCTGAGACACCTTGCTTCA
rJMFF018B22- TCTAGATGGGTGTCCATTGATGGATGATCTATTCTCCCGGTGCTGAGACACCTTGCTTCA
JMFF018B22+ TCTAGATGGGTGTCCATTGATGGATGATCTATTCTCCCGGTGCTGAGACACCTTGCTTCA
                      ____________________________________________________________
consensus TCTAGATGGGTGTCCATTGATGGATGATCTATTCTCCCGGTGCTGAGACACCTTGCTTCA
 
. : . : . : . : . : . :
JMSF042G16+ GCCTTTCCCTCTTCATCTTCTTCTTGGAGACTGGCTTCTTCTTCTTAGGGCCAAGTGTCT
rJMSF042G16- GCCTTTCCCTCTTCATCTTCTTCTTGGAGACTGGCTTCTTCTTCTTAGGGCCAAGTGTCT
JMFN045D11+ GCCTTTCCCTCTTCATCTTCTTCTTGGAGACTGGCTTCTTCTTCTTAGGGCCAAGTGTCT
JMFS039A02+ GCCTTTCCCTCTTCATCTTCTTCTTGGAGACTGGCTTCTTCTTCTTAGGGCCAAGTGTCT
rJMFF018B22- GCCTTTCCCTCTTCATCTTCTTCTTGGAGACTGGCTTCTTCTTCTTAGGGCCAAGTGTCT
JMFF018B22+ GCCTTTCCCTCTTCATCTTCTTCTTGGAGACTGGCTTCTTCTTCTTAGGGCCAAGTGTCT
                      ____________________________________________________________
consensus GCCTTTCCCTCTTCATCTTCTTCTTGGAGACTGGCTTCTTCTTCTTAGGGCCAAGTGTCT
 
. : . : . : . : . : . :
JMSF042G16+ TCTGTGCATACATGTATAGGAAGTAGTTTCCAACAAGGAATGCCAACACAAGTCCACCAA
rJMSF042G16- TCTGTGCATACATGTATAGGAAGTAGTTTCCAACAAGGAATGCCAACACAAGTCCACCAA
JMFN045D11+ TCTGTGCATACATGTATAGGAAGTAGTTTCCAACAAGGAATGCCAACACAAGTCCACCAA
JMFS039A02+ TCTGTGCATACATGTATAGGAAGTAGTTTCCAACAAGGAATGCCAACACAAGTCCACCAA
rJMFF018B22- TCTGTGCATACATGTATAGGAAGTAGTTTCCAACAAGGAATGCCAACACAAGTCCACCAA
JMFF018B22+ TCTGTGCATACATGTATAGGAAGTAGTTTCCAACAAGGAATGCCAACACAAGTCCACCAA
                      ____________________________________________________________
consensus TCTGTGCATACATGTATAGGAAGTAGTTTCCAACAAGGAATGCCAACACAAGTCCACCAA
 
. : . : . : . : . : . :
JMSF042G16+ TCACAAGCAACACAATCAATCCTGGGTTCAATCCCTTGCCTGTGACAACGTTTTTCATTG
rJMSF042G16- TCACAAGCAACACAATCAATCCTGGGTTCAATCCCTTGCCTGTGACAACGTTTTTCATTG
JMFN045D11+ TCACAAGCAACACAATCAATCCTGGGTTCAATCCCTTGCCTGTGACAACGTTTTTCATTG
JMFS039A02+ TCACAAGCAACACAATCAATCCTGGGTTCAATCCCTTGCCTGTGACAACGTTTTTCATTG
rJMFF018B22- TCACAAGCAACACAATCAATCCTGGGTTCAATCCCTTGCCTGTGACAACGTTTTTCATTG
JMFF018B22+ TCACAAGCAACACAATCAATCCTGGGTTCAATCCCTTGCCTGTGACAACGTTTTTCATTG
                      ____________________________________________________________
consensus TCACAAGCAACACAATCAATCCTGGGTTCAATCCCTTGCCTGTGACAACGTTTTTCATTG
 
. : . : . : . : . : . :
JMSF042G16+ GATCGAAAGACGGAGGAACATGCTGATCTG
rJMSF042G16- GATCGAAAGACGGAGGAACATGCTGATCTG
JMFN045D11+ GATCGAAAGACGGAGGAACATGCTGATCTGCAAA---CTCTTCTTCGTAATCCATAGCTG
JMFS039A02+ GATCGAAAGACGGAGGAACATGCTGATCTGCAAA---CTCTTCTTCGTAATCCATAGCTG
rJMFF018B22- GATCGAAAGACGGAGGAACATGCTGATCTGATTATCGTCCCTCTTCTTAAGCCA-CTCAA
JMFF018B22+ GATCGAAAGACGGAGGAACATGCTGATCTGATTATCGTCCCTCTTCTTAAGCCA-CTCAA
                      ____________________________________________________________
consensus GATCGAAAGACGGAGGAACATGCTGATCTGATTATCGTCCCTCTTCTTAAGCCA-CTCAA
 
. : . : . : . : . : . :
JMFN045D11+ AGAGGAACGA
JMFS039A02+ AGAGGAACGA
rJMFF018B22- ATCGCAGTGCTTATGATCCTTTTTCTTGTCACAGGCCAATATGTATAGTCCTCCCCTCAA
JMFF018B22+ ATCGCAGTGCTTATGATCCTTTTTCTTGTCACAGGCCAATATGTATAGTCCTCCCCTCAA
                      ____________________________________________________________
consensus ATCGCAGTGCTTATGATCCTTTTTCTTGTCACAGGCCAATATGTATAGTCCTCCCCTCAA