Previous Contig 000928:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001N20Sequence171000928 (14)gb:AK175388_18173760.024Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-82-L07.271000928 (14)
JMFF018B12Sequence576000928 (14)gb:AP003631_18317799e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058756000928 (14)gb:AK176844_18188329e-67Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-40-H22.
JMFF026D24Sequence572000928 (14)gb:AP003631_18317799e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058764000928 (14)gb:AK176844_18188324e-51Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-40-H22.
JMFF035G06Sequence594000928 (14)gb:AP003631_18317791e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058798000928 (14)gb:AK176844_18188322e-42Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-40-H22.
JMFF041F04Sequence652000928 (14)gb:AP003631_18317795e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058512000928 (14)gb:AK176844_18188325e-29Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-40-H22.
JMFF041J07Sequence630000928 (14)gb:AP003631_18317793e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058
JMFF044G17Sequence642000928 (14)gb:AP003631_18317792e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058564000928 (14)gb:AF249876_17807850.001Arabidopsis thaliana transcription factor APFI mRNA, complete cds.
JMFS054E11Sequence627000928 (14)gb:AP003631_18317793e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF044G17- GGCCAAACAAATACTTGTATGTTCAAATTATAAGCACGGA
rJMFF035G06- TTGTATGTTC-AATTATAAGCACGGA
                      ____________________________________________________________
consensus GGCCAAACAAATACTTGTATGTTCAAATTATAAGCACGGA
 
. : . : . : . : . : . :
rJMFF044G17- AACGGTGATGGTACAAGAAAACAATATCCTCATCAACAAAATGACACACATAATTATAAT
rJMFF001N20- GACACACATAANTATAAT
rJMFF035G06- AACGGTGATGGTACAAGAAAACAATATCCTCATCAACAAAATGACACACATAATTATAAT
rJMFF026D24- TATAAT
                      ____________________________________________________________
consensus AACGGTGATGGTACAAGAAAACAATATCCTCATCAACAAAATGACACACATAATTATAAT
 
. : . : . : . : . : . :
rJMFF044G17- CCCATCGGATAAAACCGGGTGAGGAAAACTAAGTTCTAATCCAGTGTCAAATGAAGACAT
rJMFF001N20- CCCATCGGATANANCCGGGTGAGGAAAACTAAGNTCTANTNCAGTGTCAAATGAAGACAT
rJMFF035G06- CCCATCGGATAAAACCGGGTGAGGAAAACTAAGTTCTAATCCAGTGTCAAATGAAGACAT
rJMFF026D24- CCCATCGGATAAAACCGGGTGAGGAAAACTAAGTTCTAATCCAGTGTCAAATGAAGACAT
                      ____________________________________________________________
consensus CCCATCGGATAAAACCGGGTGAGGAAAACTAAGTTCTAATCCAGTGTCAAATGAAGACAT
 
. : . : . : . : . : . :
rJMFF044G17- GACCTCAACGATATGAGGGAAGGAATGGGGCAATGAGCATTATTGACATACAAATGAAGA
rJMFF001N20- GACCTCNNCGATATGAGGGAANGAATGGGGNAATGAGCATTATTGACATACNNNTGANGA
rJMFF035G06- GACCTCAACGATATGAGGGAAGGAATGGGGCAATGAGCATTATTGACATACAAATGAAGA
rJMFF026D24- GACCTCAACGATATGAGGGAAGGAATGGGGCAATGAGCATTATTGACATACAAATGAAGA
rJMFF041F04- A
rJMFF018B12- ATGAGCATTATTGACATACAAATGAAGA
                      ____________________________________________________________
consensus GACCTCAACGATATGAGGGAAGGAATGGGGCAATGAGCATTATTGACATACAAATGAAGA
 
. : . : . : . : . : . :
rJMFF044G17- AACTGTGAAGAAATTTTTCACTCAATGTCCTACACTCCCTAGTGTTGCTAAAACACTCTA
rJMFF001N20- AACTGTGAAGAAANTTNTCACTNAATGNCCTACACTCCCTANTGTTGCTANNACACTCTA
rJMFF035G06- AACTGTGAAGAAATTTTTCACTCAATGTCCTACACTCCCTAGTGTTGCTAAAACACTCTA
rJMFF026D24- AACTGTGAAGAAATTTTTCACTCAATGTCCTACACTCCCTAGTGTTGCTAAAACACTCTA
rJMFF041F04- AACTGGGAAGAAATTTTTCACTCAATGTCCTACACTCCCTAGGGTTGCTAAAACACTCTA
rJMFF018B12- AACTGTGAAGAAATTTTTCACTCAATGTCCTACACTCCCTAGTGTTGCTAAAACACTCTA
                      ____________________________________________________________
consensus AACTGTGAAGAAATTTTTCACTCAATGTCCTACACTCCCTAGTGTTGCTAAAACACTCTA
 
. : . : . : . : . : . :
rJMFF044G17- ATTTTGTTTCTCCATTCTCCAGTAAATTTAAGCAAAGATCCATCCATATTTGATATGCAA
rJMFF001N20- NTTTTGTNTCTCCATTCTCCAGNAAATTTAANCANAGATCCGTCCATATTTGATATGCAA
rJMFF035G06- ATTTTGTTTCTCCATTCTCCAGTAAATTTAAGCAAAGATCCATCCATATTTGATATGCAA
rJMFF026D24- ATTTTGTTTCTCCATTCTCCAGTAAATTTAAGCAAAGATCCATCCATATTTGATATGCAA
rJMFF041F04- ATTTTGTTTCTCCATTCTCCAGTAAATTTAAGCAAAGATCCATCCATATTTGATATGCAA
rJMFF018B12- ATTTTGTTTCTCCATTCTCCAGTAAATTTAAGCAAAGATCCATCCATATTTGATATGCAA
                      ____________________________________________________________
consensus ATTTTGTTTCTCCATTCTCCAGTAAATTTAAGCAAAGATCCATCCATATTTGATATGCAA
 
. : . : . : . : . : . :
rJMFF044G17- GCCTGGGGGGCGGCCAAAATTATTAGAGACATGAACCATGGGCATTTCCATCTTGTTAAT
rJMFF001N20- GCCTGGGGGGCGG
rJMFF035G06- GCCTGGGGGGCGGCCAAAATTATTAGAGACATGAACCATGGGCATTTCCTTCTTGTTAAT
rJMFF026D24- GCCTGGGGGGCGGCCAAAATTATTAGAGACATGAACCATGGGCATTTCCTTCTTGTTAAT
rJMFF041F04- GCCTGGGGGGCGGCCAAAATTATTAGAGACATGAACCATGGGCATTTCCTTCTTGTTAAT
rJMFF018B12- GCCTGGGGGGCGGCCAAAATTATTAGAGACATGAACCATGGGCATTTCCTTCTTGTTAAT
                      ____________________________________________________________
consensus GCCTGGGGGGCGGCCAAAATTATTAGAGACATGAACCATGGGCATTTCCTTCTTGTTAAT
 
. : . : . : . : . : . :
rJMFF044G17- CTGCCCATTACAACAAAATGTCAGTTAACATCAAATTCACCAAATACTCACTCAACCTCT
rJMFF035G06- CTGCCCATTACAACAAAATGTCAGTTAACATCAAATTCACCAAATACTCACTCAACCTCT
rJMFF026D24- CTGCCCATTACAACAAAATGTCAGTTAACATCAAATTCACCAAATACTCACTCAACCTCT
rJMFF041F04- CTGCCCATTACAACAAAATGTCAGTTAACATCAAATTCACCAAATACTCACTCAACCTTT
rJMFF018B12- CTGCCCATTACAACAAAATGTCAGTTAACATCAAATTCACCAAATACTCACTCAACCTCT
                      ____________________________________________________________
consensus CTGCCCATTACAACAAAATGTCAGTTAACATCAAATTCACCAAATACTCACTCAACCTCT
 
. : . : . : . : . : . :
rJMFF044G17- AACTTGCGCTTAAGAAGCCTTTGGCGCATTATTGGGTAGGATGAGGTCAGGGGGTGTTTC
rJMFF035G06- AACTTGCGCTTAAGAAGCCTTTGGCGCATTATTGGGTAGGATGAGGTCAGGGGGTGTTTC
rJMFF026D24- AACTTGCGCTTAAGAAGCCTTTGGCGCATTATTGGGTAGGATGAGGTCAGGGGGTGTTTC
rJMFF041F04- AACTTGCGCTTAAAAAGCCTTTGGCGCATTATTGGGTAGGATGAGGTCAGGGGGTGTTTC
rJMFF018B12- AACTTGCGCTTAAGAAGCCTTTGGCGCATTATTGGGTAGGATGAGGTCAGGGGGTGTTTC
                      ____________________________________________________________
consensus AACTTGCGCTTAAGAAGCCTTTGGCGCATTATTGGGTAGGATGAGGTCAGGGGGTGTTTC
 
. : . : . : . : . : . :
rJMFF044G17- ACGAACAACACCCAGTATTGAATCGTTGTCTTCATCCTTCTTCT
rJMFF035G06- ACGAACAACACCCAGTACTGAATCGTTGTCTTCATCCTTCTTCTTGCGAAGAACCTTCTC
rJMFF026D24- ACGAACAACACCCAGTATTGAATCGTTGTCTTCATCCTTCTTCTTGCGAAGAACCTTCTC
rJMFF041F04- ACGAACAACACCCAGTATTGAATCGTTGTCTTCATCCTTCTTCTTGCGAAGAACCTTCTC
rJMFF018B12- ACGAACAACACCCAGTATTGAATCGTTGTCTTCATCCTTCTTCTTGCGAAGAACCTTCTC
                      ____________________________________________________________
consensus ACGAACAACACCCAGTATTGAATCGTTGTCTTCATCCTTCTTCTTGCGAAGAACCTTCTC
 
. : . : . : . : . : . :
rJMFF035G06- AAACTCATTCTCATCCAAGCTCTTTGCATTTTCAGCTGCATGACCCTGTTTTAAATTTGA
rJMFF026D24- AAACTCGTTCTCATCCAAGCTCTTTGCATTTTCAGCTGCATGACCCTGTTTTAAATTTGA
rJMFF041F04- AAACTCATTCTCATCCAAGCTCTTTGCATTTTCAGCTGCATGACCCTGTTTTAAATTTGA
rJMFF018B12- AAACTCATTCTCATCCAAGCTCTTTGCATTTTCAGCTGCATGACCCTGTTTTAAATTTGA
                      ____________________________________________________________
consensus AAACTCATTCTCATCCAAGCTCTTTGCATTTTCAGCTGCATGACCCTGTTTTAAATTTGA
 
. : . : . : . : . : . :
rJMFF035G06- GTAGTTGAGGGCTGACTGGGAGATGAAAGCTATTTCTTCTTCTGTGAGTTTCCTTAAGAA
rJMFF026D24- GTAGTTGAGGGCTGACTGGGAGATGAAAGCTATTTCTTCTTCTGTGAGTTTCCTTAAGAA
rJMFF041F04- GTAGTTGAGGGCTGACTGGGAGATGAAAGCTATTTCTTCTTCTGGGAGTTTCCTTAAGAA
rJMFF018B12- GTAGTTGAGGGCTGACTGGGAGATGAAAGCTATTTCTTCTTCTGTGAGTTTCCTTAAGAA
                      ____________________________________________________________
consensus GTAGTTGAGGGCTGACTGGGAGATGAAAGCTATTTCTTCTTCTGTGAGTTTCCTTAAGAA
 
. : . : . : . : . : . :
rJMFF035G06- CTTGGCAGGATTTCCGCCCCAAACCTCTCCACAAGGAATCCTTGTATTCTGTCTCACAAG
rJMFF026D24- CTTGGCAGGATTTCCGCCCCAAACCTCTCCACAAGGAATCCTTGTATTCTGTCTCACAAG
rJMFF041F04- CTTGGCAGGATTTCCGCCCCAAACCTCTCCA
rJMFF018B12- CTTGGCAGGATTTCCGCCCCAAACCTCTCCACAAGGAATCCTTGTATTCTGTCTCACAAG
JMFF044G17+ CAAGGAATCCTTGTATTCTGTCTCACAAG
JMFS054E11+ G
JMFF041J07+ G
                      ____________________________________________________________
consensus CTTGGCAGGATTTCCGCCCCAAACCTCTCCACAAGGAATCCTTGTATTCTGTCTCACAAG
 
. : . : . : . : . : . :
rJMFF035G06- AGCACCAGCAGCAATCATGGCATTTTTCTCTACAACCACCCCATCAAGCAAGG
rJMFF026D24- AGCACCAGCAGCAATCATGGCATTTTTCTCTACAACCACCCCATCAAGCAAGGTTGCACC
rJMFF018B12- AGCACCAGCAGCAATCATGGCATTTTTCTCTACAACCACCCCATCAAGCAAGGTTGCACC
JMFF044G17+ AGCACCAGCAGCAATCATGGCATTTTTCTCTACAACCACCCCATCAAGCAAGGTTGCACC
JMFS054E11+ AGCACCAGCAGCAATCATGGCATTTTTCTCTACAACCACCCCATCAAGCAAGGTTGCACC
JMFF041J07+ AGCACCAGCAGCAATCATGGCATTTTTCTCTACAACCACCCCATCAAGCAAGGTTGCACC
JMFF035G06+ AGGTTGCACC
JMFF026D24+ GGTTGCACC
JMFF041F04+ CAGCAGCAATCATGGCATTTTTCTCTACAACCACCCCATCAAGCAAGGTTGCACC
                      ____________________________________________________________
consensus AGCACCAGCAGCAATCATGGCATTTTTCTCTACAACCACCCCATCAAGCAAGGTTGCACC
 
. : . : . : . : . : . :
rJMFF026D24- CATACCAACAAATGCCTCATCTTCAACAGTACATCC
rJMFF018B12- CATACCAACAAATGCCTCATCTTCAACAGTACATCCATGTAA-GACAGCACTATGACCAA
JMFF044G17+ CATACCAACAAATGCCTCATCTTCAACAGTACATCCATGTAA-GACAGCACTATGACCAA
JMFS054E11+ CATACCAACAAATGCCTCATCTTCAACAGTACATCCATGTAA-GACAGCACTATGACCAA
JMFF041J07+ CATACCAACAAATGCCTCATCTTCAACAGTACATCCATGTAA-GACAGCACTATGACCAA
JMFF035G06+ CATACCAACAAATGCNTCATCTTCAACAGTACATCCATGTAAGGACAGCACTATGACCAA
JMFF026D24+ CATACCAACAAATGCCTCATCTTCAACAGTACATCCATGTAA-GACAGCACTATGACCAA
JMFF041F04+ CATACCAACAAATGCCTCATCTTCAACAGTACATCCATGTAA-GACAGCACTATGACCAA
JMFF018B12+ TTCAACAGTACATCCATGTAA-GGCAGCACTATGACCAA
                      ____________________________________________________________
consensus CATACCAACAAATGCCTCATCTTCAACAGTACATCCATGTAA-GACAGCACTATGACCAA
 
. : . : . : . : . : . :
rJMFF018B12- CAGTAACGTTGTTGCCAATAATTGTCGGCAACACTTTTCCAGTTAGATTGGATTTGGCTA
JMFF044G17+ CAGTAACGTTGTTGCCAATAATTGTCGGCAACACTTTTCCAGTTAGATTGGATTTGGCTA
JMFS054E11+ CAGTAACGTTGTTGCCAATAATTGTCGGCAACACTTTTCCAGTTAGATTGGATTTGGCTA
JMFF041J07+ CAGTAACGTTGTTGCCAATAATTGTCGGCAACACTTTTCCAGTTAGATTGGATTTGGCTA
JMFF035G06+ CAGTAACGTTGTTGCCAATAATTGTCGGCAACACTTTTCCAGTTAGATTGGATTTGGCTA
JMFF026D24+ CAGTAACGTTGTTGCCAATAATTGTCGGCAACACTTTTCCAGTTAGATTGGATTTGGCTA
JMFF041F04+ CAGTAACGTTGTTGCCAATAATTGTCGGCAACACTTTTCCAGTTAGATTGGATTTGGCTA
JMFF018B12+ CAGTAACGTTGTTGCCAATAATTGTCGGCAACACTTTTCCAGTTAGATTGGATTTGGCTA
                      ____________________________________________________________
consensus CAGTAACGTTGTTGCCAATAATTGTCGGCAACACTTTTCCAGTTAGATTGGATTTGGCTA
 
. : . : . : . : . : . :
rJMFF018B12- CATGAACAA
JMFF044G17+ CATGAACAAGAGAGTTGTCTTGGATATTGGTTCCAGTTCCGATGCTTACGCTATTCACAT
JMFS054E11+ CATGAACAAGAGAGTTGTCTTGGATATTGGTTCCAGTTCCGATGCTTACGCTATTCACAT
JMFF041J07+ CATGAACAAGAGAGTTGTCTTGGATATTGGTTCCAGTTCCGATGCTTACGCTATTCACAT
JMFF035G06+ CATGAACAAGAGAGTTGTCTTGGATATTGGTTCCAGTTCCGATGCTTACGCTATTCACAT
JMFF026D24+ CATGAACAAGAGAGTTGTCTTGGATACTGGTTCCAGTTCCGATGCTTACGCTATTCACAT
JMFF041F04+ CATGAACAAGAGAGTTGTCTTGGATATTGGTTCCAGTTCCGATGCTTACGCTATTCACAT
JMFF018B12+ CATGAACAAGAGAGTTGTCTTGGATATTGGTTCCAGTTCCGATGCTTACGCTATTCACAT
                      ____________________________________________________________
consensus CATGAACAAGAGAGTTGTCTTGGATATTGGTTCCAGTTCCGATGCTTACGCTATTCACAT
 
. : . : . : . : . : . :
JMFF044G17+ CACCTCGTAGAACACATCCATA-CCAGATAGAGG-AATGCCTTCCAACTTGAACATCCCC
JMFS054E11+ CACCTCGTAGAACACATCCATA-CCAGATAGAGG-AATGCCTTCCAACTTGAACATCCCC
JMFF041J07+ CACCTCGTAGAACACATCCATA-CCAGATAGAGG-AATGCCTTCCAACTTGAACATCCCC
JMFF035G06+ CACCTCGTAGAACACATCCATA-CCAGATAGAGGAAATGCCTTCCAACTTGAACATCCCC
JMFF026D24+ CACCTCGTAGAACACATCCATA-CCAGATAGAGG-AATGCCTTCCAACTTGAACATCTCC
JMFF041F04+ CACCTCGTAGAACACATCCATA-CCAGATAGAGG-AATGCCTTCCAACTTGAACATCCCC
JMFF018B12+ CACCTCGTAGAACACATCCATACCCAGATAGAGG-AATGCCTTCCAACTTGAACATCCCC
                      ____________________________________________________________
consensus CACCTCGTAGAACACATCCATA-CCAGATAGAGG-AATGCCTTCCAACTTGAACATCCCC
 
. : . : . : . : . : . :
JMFF044G17+ AATGATAGAAGCACTTGGTGCAACAAATGCTTCTCTATGAACTGAAGGAACTTTATCAAA
JMFS054E11+ AATGATAGAAGCACTTGGTGCAACAAATGCTTCTCTATGAACTGAAGGAACTTTATCAAA
JMFF041J07+ AATGATAGAAGCACTTGGTGCAACAAATGCTTCTCTATGAACTGAAGGAACTTTATCAAA
JMFF035G06+ AATGATAGAAGCACTTGGTGCAACAAATGCTTCTCTATGAACTGAAGGAACTTTATCAAA
JMFF026D24+ AATGATAGAAGCACTTGGTGCAACAAATGCTTCTCTATGAACTGAAGGAACTTTATCAAA
JMFF041F04+ AATGATAGAAGCACTTGGTGCAACAAATGCTTCTCTATGAACTGAAGGAACTTTATCAAA
JMFF018B12+ AATGATAGAAGCACTTGGTGCAACAAATGCTTCTCTATGAACTGAAGGAACTTTATCAAA
                      ____________________________________________________________
consensus AATGATAGAAGCACTTGGTGCAACAAATGCTTCTCTATGAACTGAAGGAACTTTATCAAA
 
. : . : . : . : . : . :
JMFF044G17+ CAAGTTCATAAGGACTCTGTGCCTAGACAGTTGTTCATGGAAGTAGTAGTTGCCTTGGAG
JMFS054E11+ CAAGTTCATAAGGACTCTGTGCCTAGACAGTTGTTCATGGAAGTAGTAGTTGCCTTGGAG
JMFF041J07+ CAAGTTCATAAGGACTCTGTGCCTAGACAGTTGTTCATGGAAGTAGTAGTTGCCTTGGAG
JMFF035G06+ CAAGTTCATAAGGACTCTGTGCCTAGACAGTTGTTCATGGAAGTAGTAGTTGCCTTGGAG
JMFF026D24+ CAAGTTCATAAGGACTCTGTGCCTAGACAGTTGTTCATGGAAGTAGTAGTTGCCTTGGAG
JMFF041F04+ CAAGTTCATAAGGACTCTGTGCCTAGACAGTTGTTCATGGAAGTAGTAGTTGCCTTGGAG
JMFF018B12+ CAAGTTCATAAGGACTCTGTGCCTAGACAGTTGTTCATGGAAGTAGTAGTTGCCTTGGAG
                      ____________________________________________________________
consensus CAAGTTCATAAGGACTCTGTGCCTAGACAGTTGTTCATGGAAGTAGTAGTTGCCTTGGAG
 
. : . : . : . : . : . :
JMFF044G17+ GCGACAGCCCAGGCGATCGAGTGCTTGACCCGTTTCGCGGATCCAGAATCCGACAGTGTA
JMFS054E11+ GCGACAGCCCAGGCGATCGAGTGCTTGACCCGTTTCGCGGATCCAGAATCCGACAGTGTA
JMFF041J07+ GCGACAGCCCAGGCGATCGAGTGCTTGACCCGTTTCGCGGATCCAGAATCCGACAGTGTA
JMFF035G06+ GCGACAGCCCAGGCGATCGAGTGCTTGACCCGTTTCGCGGATCCAGAATCCGACAGTGTA
JMFF026D24+ GCGACAGCCCAGGCGATCGAGTGCTTGACCCGTTTCGCGGATCCAGAATCCGACAGTGTA
JMFF041F04+ GCGACAGCCCAGGCGATCGAGTGCTTGACCCGTTTCGCGGATCCAGAATCCGACAGTGTA
JMFF001N20+ TGACCCGTTTCGCGGATCCAGAATCNGACAGTGTA
JMFF018B12+ GCGACAGCCCAGGCGATCGAGTGCTTGACCCGTTTCGCGGATCCAGAATCCGACAGTGTA
                      ____________________________________________________________
consensus GCGACAGCCCAGGCGATCGAGTGCTTGACCCGTTTCGCGGATCCAGAATCCGACAGTGTA
 
. : . : . : . : . : . :
JMFF044G17+ AAATGCTCTCCCAAGGGAACCCATCTCCTTCAATTCCTTCGCCTACTCCTTCAATTCCAG
JMFS054E11+ AAATGCTCTCCCAAGGGAACCCATCTCCTTCAATTCCTTCGCCTACTCCTTCAATTCCAG
JMFF041J07+ AAATGCTCTCCCAAGGGAACCCATCTCCTTCAATTCCTTCGCCTACTCCTTCAATTCCAG
JMFF035G06+ AAATGCTCTCCCAAGGGAACCCATCTCCTTCAATTCCTTCGCCTACTCCTTCAATTCCAG
JMFF026D24+ AAATGCTCTCCCAAGGGAACCCATCTCCTTCAATTCCTTCGCCTACTCCTTCAATTCCAG
JMFF041F04+ AAATGCTCTCCCAAGGGAACCCATCTCCTTCAATTCCTTCGCCTACTCCTTCAATTCCAG
JMFF001N20+ AAATGCTCTCCCAAGGGAACCCATCTCNTTCAATTCCTTCGCCTACTCCTTCAATTCCAG
JMFF018B12+ AAATGCTCTCCCAAGGGAACCCATCTCCTTCAATTCCTTCGCCTACTCCTTCAATTCCAG
                      ____________________________________________________________
consensus AAATGCTCTCCCAAGGGAACCCATCTCCTTCAATTCCTTCGCCTACTCCTTCAATTCCAG
 
. : . : . : . : . : . :
JMFF044G17+ AACGGATTCAAAGATTGGCGATTAAAGATGATATAGATATGGCTTCTCAAAGTGTAAGAG
JMFS054E11+ AACGGATTCAAAGATTGGCGATTAAAGATGATATAGATATGGCTTCTCAAAGTGTAAGAG
JMFF041J07+ AACGGATTCAAAGATTGGCGATTAAAGATGATATAGATATGGCTTCTCAAAGTGTAAGAG
JMFF035G06+ AACGGATTCAAAGATTGGCGATTAAAGATGATATAGATATGGCTTCTCAAAGTGTAAGAG
JMFF026D24+ AACGGATTCAAAGATTGGCGATTAAAGATGATATAGATATGGCTTCTCAAAGTGTAAGAG
JMFF041F04+ AACGGATTCAAAGATTGGCGATTAAAGATGATATAGATATGGCTTCTCAAAGTGTAAGAG
JMFF001N20+ AACGGATTCAAAGATTGGCGATTAAAGATGATATAGATATGGCTTCTCAAAGTGTAAGAG
JMFF018B12+ AACGGATTCAAAGATTGGCGATTAAAGATGATATAGATATGGCTTCTCAAAGTGTAAGAG
                      ____________________________________________________________
consensus AACGGATTCAAAGATTGGCGATTAAAGATGATATAGATATGGCTTCTCAAAGTGTAAGAG
 
. : . : . : . : . : . :
JMFF044G17+ CCTTCAGCTCGCTTCC
JMFS054E11+ CCTTCAGCTCGCTTCCGGGGCAGAATGGA
JMFF041J07+ CCTTCAGCTCGCTTCCGGGGCAGAATGGAGTG
JMFF035G06+ CCTTCAGCTCGCTTCCGGGGCAGAATGGAGTGTGGAGACCATA
JMFF026D24+ CCTTCAGCTCGCTTCCGGGGCAGAAT
JMFF041F04+ CCTTCAGCTCGCTTCCGGGGCAGAATGGAGTGTGGAGACCATANACAAAGAAGCGAAAAT
JMFF001N20+ CCTTCAGCTCGCTTCC
JMFF018B12+ CCTTCAGCTCGCTTCCGGGGCAGAATGGAGTGTGGAGACCATA-ACAAAGAAGCGAAAAT
                      ____________________________________________________________
consensus CCTTCAGCTCGCTTCCGGGGCAGAATGGAGTGTGGAGACCATANACAAAGAAGCGAAAAT