Previous Contig 000923:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017P18Sequence604000923 (3)pir|T45719|T457197e-60hypothetical protein F1P2.140 - Arabidopsis thaliana>gb:ATF1P2_1549429 Arabidops795021059gb:AY128311_15806109e-87Arabidopsis thaliana putative protein (At3g47560) mRNA, complete cds.
JMFS088G10Sequence619000923 (3)pir|T45719|T457195e-64hypothetical protein F1P2.140 - Arabidopsis thaliana>gb:ATF1P2_1549429 Arabidops
JMSF017C01Sequence384000923 (3)pir|H86421|H864212e-23hypothetical protein F1N18.12 - Arabidopsis thaliana>gb:AE005172_891832 Arabidop785011938 (2)pir|T45719|T457198e-40hypothetical protein F1P2.140 - Arabidopsis thaliana>gb:ATF1P2_1549429 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF017P18+ TCTT
                      ____________________________________________________________
consensus TCTT
 
. : . : . : . : . : . :
JMFS088G10+ ACCAGAA
JMFF017P18+ TCCAAGAAATCATTGCCCAAGCGCTCTTCAATGCCTCTATTCAAATCATAGCGACCAGAA
                      ____________________________________________________________
consensus TCCAAGAAATCATTGCCCAAGCGCTCTTCAATGCCTCTATTCAAATCATAGCGACCAGAA
 
. : . : . : . : . : . :
JMFS088G10+ ACATTGACCACAGTATGAACATCATGATACTTTGAAGCGTATAGGAGCACAACATTTCCA
JMFF017P18+ ACATTGACCACAGTATGAACATCATGATACTTTGAAGCGTATAGGAGCACAACATTTCCA
                      ____________________________________________________________
consensus ACATTGACCACAGTATGAACATCATGATACTTTGAAGCGTATAGGAGCACAACATTTCCA
 
. : . : . : . : . : . :
JMFS088G10+ CCTTTACTATGTCCAAGAATGGCCGTTACTCTGCAGTTTTGCCCAATAAAGTGTTCAACA
JMFF017P18+ CCTTTACTATGTCCAAGAATGGCCGTTACTCTGCAGTTTTGCCCAATAAAGTGTTCAACA
                      ____________________________________________________________
consensus CCTTTACTATGTCCAAGAATGGCCGTTACTCTGCAGTTTTGCCCAATAAAGTGTTCAACA
 
. : . : . : . : . : . :
JMFS088G10+ ACGGAATGCAAATCATCAGCCTCTCTCTGATAGTGACCGTACCTAAATGAGCCTTCACTT
JMSF017C01+ CCTTCACTT
JMFF017P18+ ACGGAATGCAAATCATCAGCCTCTCTCTGATAGTGACCGTACCTAAATGAGCCTTCACTT
                      ____________________________________________________________
consensus ACGGAATGCAAATCATCAGCCTCTCTCTGATAGTGACCGTACCTAAATGAGCCTTCACTT
 
. : . : . : . : . : . :
JMFS088G10+ TCCCCATTTCCAGCAAAGTCAAAGCGAAATGCACTTATTCCTTCTTTCTCCAATGCAGTG
JMSF017C01+ TCCCCGTTACCAGCGAAATCAAACCGAAATGCACTTATTCCTTCTGCCTCCAATGCAGCA
JMFF017P18+ TCCCCATTTCCAGCAAAGTCAAAGCGAAATGCACTTATTCCTTCTTTCTCCAATGCAGTG
                      ____________________________________________________________
consensus TCCCCATTTCCAGCAAAGTCAAAGCGAAATGCACTTATTCCTTCTTTCTCCAATGCAGTG
 
. : . : . : . : . : . :
JMFS088G10+ GCTACGCCCACCATTATTCTGTTCTCCTTTTTGGATCGAAAACCGTGGCACAACACCACA
JMSF017C01+ GCTAGGCTCACCATTATCCTGTCATTCTTTGTGCATAGGAAACCATGACACAACACCACA
JMFF017P18+ GCTACGCCCACCATTATTCTGTTCTCCTTTTTGGATCGAAAACCGTGGCACAACACCACA
                      ____________________________________________________________
consensus GCTACGCCCACCATTATTCTGTTCTCCTTTTTGGATCGAAAACCGTGGCACAACACCACA
 
. : . : . : . : . : . :
JMFS088G10+ ACATCTGGACATCCAGTGTCATGCAGTATACCCACTAGCTTCTCATTATACTTGTTTGGT
JMSF017C01+ ATATCTGGAGATCCAGTTTCATGCAGTATACCCACCAGCTTCTCATTATATTTGTTTTGT
JMFF017P18+ ACATCTGGACATCCAGTGTCATGCAGTATACCCACTAGCTTCTCATTATACTTGTTTGGT
                      ____________________________________________________________
consensus ACATCTGGACATCCAGTGTCATGCAGTATACCCACTAGCTTCTCATTATACTTGTTTGGT
 
. : . : . : . : . : . :
JMFS088G10+ ATGGTGATTTTCTTCTGTGCAATGCCTGGGTT
JMSF017C01+ ATGCTCATTTTCTTCTGTGTAATCCCTGGGTT
JMFF017P18+ ATGGTGATTTTCTTCTGTGCAATGCCTGGGTTCGAATCCATCTTGAAGATTGCTCTGGTT
                      ____________________________________________________________
consensus ATGGTGATTTTCTTCTGTGCAATGCCTGGGTTCGAATCCATCTTGAAGATTGCTCTGGTT
 
. : . : . : . : . : . :
JMFF017P18+ TTGATGGTGTGGGTAGCTGAAGGCGTGAAGCGTACCGGCGAGTTGTGAGCTCCTTTGTAG
                      ____________________________________________________________
consensus TTGATGGTGTGGGTAGCTGAAGGCGTGAAGCGTACCGGCGAGTTGTGAGCTCCTTTGTAG
 
. : . : . : . : . : . :
JMFF017P18+ TCAGAGGCGTCGCGGGACTGAACGCCTGAACCAGACAAAACCACTGAAATGACTCCGGAG
                      ____________________________________________________________
consensus TCAGAGGCGTCGCGGGACTGAACGCCTGAACCAGACAAAACCACTGAAATGACTCCGGAG