Previous Contig 000920:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017P07Sequence532000920 (2)gb:AF092915_17675738e-47Nicotiana tabacum cytochrome P450-dependent fatty acid hydroxylase (CYP94A4) mRN694009036 (2)gb:AF092915_17675733e-79Nicotiana tabacum cytochrome P450-dependent fatty acid hydroxylase (CYP94A4) mRN
JMSF032C17Sequence535000920 (2)gb:AF092915_17675734e-47Nicotiana tabacum cytochrome P450-dependent fatty acid hydroxylase (CYP94A4) mRN169009036 (2)gb:AF092913_17675714e-10Nicotiana tabacum cytochrome P450-dependent fatty acid hydroxylase (CYP94A6) mRN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032C17+ GAACCAGGCGTTCCGTGAGCTCCGTATCCACGACGATCTCCACGAATTTACGCAGA
JMFF017P07+ CAGGCGTTCCGTGAGCTCCGTATCCACGACGATCTCCACGAATTTACGCAGA
                      ____________________________________________________________
consensus GAACCAGGCGTTCCGTGAGCTCCGTATCCACGACGATCTCCACGAATTTACGCAGA
 
. : . : . : . : . : . :
JMSF032C17+ GACCTCATATTAAACTCGTAGCTCGCCAATTGCCTCTGAAACTTCCATGTCGGCCCATCG
JMFF017P07+ GACCTCATATTAAACTCGTAGCTCGCCAATTGCCTCTGAAACTTCCATGTCGGCCCATCG
                      ____________________________________________________________
consensus GACCTCATATTAAACTCGTAGCTCGCCAATTGCCTCTGAAACTTCCATGTCGGCCCATCG
 
. : . : . : . : . : . :
JMSF032C17+ GTGTTAAAAATCCCCTGACCCATCAAATCCGCTAGGGCTCTCTTGGAGATCTCCCCTTTC
JMFF017P07+ GTGTTAAAAATCCCCTGACCCATCAAATCCGCTAGGGCTCTCTTGGAGATCTCCCCTTTC
                      ____________________________________________________________
consensus GTGTTAAAAATCCCCTGACCCATCAAATCCGCTAGGGCTCTCTTGGAGATCTCCCCTTTC
 
. : . : . : . : . : . :
JMSF032C17+ TGGTAGACATGGAAGTGGGTTTTGAGCATGTGTTCCACGTTGGAAGGGTTAGCGGTGAAG
JMFF017P07+ TGGTAGACATGGAAGTGGGTTTTGAGCATGTGTTCCACGTTGGAAGGGTTAGCGGTGAAG
                      ____________________________________________________________
consensus TGGTAGACATGGAAGTGGGTTTTGAGCATGTGTTCCACGTTGGAAGGGTTAGCGGTGAAG
 
. : . : . : . : . : . :
JMSF032C17+ ACTTGGACGTAGCCCAGAGGGCGGTGGAGGACGAACGTTAGGTTTCCGGTGCTGTTTATC
JMFF017P07+ ACTTGGACGTAGCCCAGAGGGCGGTGGAGGACGAACGTTAGGTTTCCGGTGCTGTTTATC
                      ____________________________________________________________
consensus ACTTGGACGTAGCCCAGAGGGCGGTGGAGGACGAACGTTAGGTTTCCGGTGCTGTTTATC
 
. : . : . : . : . : . :
JMSF032C17+ ACCTCCGCGATCCACTGCACGCGGCGGCGCTGGTTGGCGAGGATGGAGAAGAAGGAGCCG
JMFF017P07+ ACCTCCGCGATCCACTGCACGCGGCGGCGCTGGTTGGCGAGGATGGAGAAGAAGGAGCCG
                      ____________________________________________________________
consensus ACCTCCGCGATCCACTGCACGCGGCGGCGCTGGTTGGCGAGGATGGAGAAGAAGGAGCCG
 
. : . : . : . : . : . :
JMSF032C17+ ATGATTGGGTAGGCTCTGGGGATCTTGGTGGAGTTTGGAGGGAAGAGATTGTTGAGAGTT
JMFF017P07+ ATGATTGGGTAGGCTCTGGGGATCTTGGTGGAGTTTGGAGGGAAGAGATTGTTGAGAGTT
                      ____________________________________________________________
consensus ATGATTGGGTAGGCTCTGGGGATCTTGGTGGAGTTTGGAGGGAAGAGATTGTTGAGAGTT
 
. : . : . : . : . : . :
JMSF032C17+ TTCTTCAAGTTGATGGTGAGGAGAAAGAGCAATAATGGGAATGCTAGGAAGGTGGTGAAG
JMFF017P07+ TTCTTCAAGTTGATGGTGAGGAGAAAGAGCAATAATGGGAATGCTAGGAAGGTGGTGAAG
                      ____________________________________________________________
consensus TTCTTCAAGTTGATGGTGAGGAGAAAGAGCAATAATGGGAATGCTAGGAAGGTGGTGAAG
 
. : . : . : . : . : . :
JMSF032C17+ AGGATTAATGGTGAGATTATTGAGATCTCTGCCATTTTTTCTTCTCAGCTTTTGGGTGC
JMFF017P07+ AGGATTAATGGTGAGATTATTGAGATCTCTGCCATTTTTTCTTCTCAGCTTTTGGGTGCA
                      ____________________________________________________________
consensus AGGATTAATGGTGAGATTATTGAGATCTCTGCCATTTTTTCTTCTCAGCTTTTGGGTGCA