Previous Contig 000917:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017O03Sequence570000917 (2)gb:AY052191_15625652e-61Arabidopsis thaliana AT4g01710/T15B16_22 mRNA, complete cds.>gb:AY143806_1583263555000917 (2)gb:AY052191_15625652e-61Arabidopsis thaliana AT4g01710/T15B16_22 mRNA, complete cds.>gb:AY143806_1583263

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017O03+ GATTTAAGCTGAATCAATATCCAGATCTGAA
JMFF017O03- GATTTAAGCTGAATCAATATCCAGATCTGAA
                      ____________________________________________________________
consensus GATTTAAGCTGAATCAATATCCAGATCTGAA
 
. : . : . : . : . : . :
rJMFF017O03+ AGGTTGAGTTGGAGTTGGGTGAATGGCGAAATTCGTTGAAGCAGATAATGCAGAAGCTAT
JMFF017O03- AGGTTGAGTTGGAGTTGGGTGAATGGCGAAATTCGTTGAAGCAGATAATGCAGAAGCTAT
                      ____________________________________________________________
consensus AGGTTGAGTTGGAGTTGGGTGAATGGCGAAATTCGTTGAAGCAGATAATGCAGAAGCTAT
 
. : . : . : . : . : . :
rJMFF017O03+ AATTACAAGGATTGAGCATAAGTCCCGGAAGATCGAGAGCCTCCTCAAACAGTATAAACC
JMFF017O03- AATTACAAGGATTGAGCATAAGTCCCGGAAGATCGAGAGCCTCCTCAAACAGTATAAACC
                      ____________________________________________________________
consensus AATTACAAGGATTGAGCATAAGTCCCGGAAGATCGAGAGCCTCCTCAAACAGTATAAACC
 
. : . : . : . : . : . :
rJMFF017O03+ AGTGGAAGCTCTGAAAACAGCTCTTGAAGGGTCGCCTCCCAAGACCAAAGATGAAAGATG
JMFF017O03- AGTGGAAGCTCTGAAAACAGCTCTTGAAGGGTCGCCTCCCAAGACCAAAGATGAAAGATG
                      ____________________________________________________________
consensus AGTGGAAGCTCTGAAAACAGCTCTTGAAGGGTCGCCTCCCAAGACCAAAGATGAAAGATG
 
. : . : . : . : . : . :
rJMFF017O03+ CAAGTCTGCGAATTGGATTGTAGTGCACAGGGCAATTATGGCTATAAAGGATTTGGACAG
JMFF017O03- CAAGTCTGCGAATTGGATTGTAGTGCACAGGGCAATTATGGCTATAAAGGATTTGGACAG
                      ____________________________________________________________
consensus CAAGTCTGCGAATTGGATTGTAGTGCACAGGGCAATTATGGCTATAAAGGATTTGGACAG
 
. : . : . : . : . : . :
rJMFF017O03+ CTTGTTCTCTTCTCTAGATCCTGAGTACTATGATATTCTAATGAAGTACCTATACAGAGG
JMFF017O03- CTTGTTCTCTTCTCTAGATCCTGAGTACTATGATATTCTAATGAAGTACCTATACAGAGG
                      ____________________________________________________________
consensus CTTGTTCTCTTCTCTAGATCCTGAGTACTATGATATTCTAATGAAGTACCTATACAGAGG
 
. : . : . : . : . : . :
rJMFF017O03+ CTTGTCTACCGGAGATCGTCCCACTTGTGATCAATGCCTAAGAATTCATGAAAAGCTGAC
JMFF017O03- CTTGTCTACCGGAGATCGTCCCACTTGTGATCAATGCCTAAGAATTCATGAAAAGCTGAC
                      ____________________________________________________________
consensus CTTGTCTACCGGAGATCGTCCCACTTGTGATCAATGCCTAAGAATTCATGAAAAGCTGAC
 
. : . : . : . : . : . :
rJMFF017O03+ CGAGAAAGCTGGGTTGGGTTGTATAGTACGTTGTCTAGCTGACACACAAAATACCGTCTA
JMFF017O03- CGAGAAAGCTGGGTTGGGTTGTATAGTACGTTGTCTAGCTGACACACAAAATACCGTCTA
                      ____________________________________________________________
consensus CGAGAAAGCTGGGTTGGGTTGTATAGTACGTTGTCTAGCTGACACACAAAATACCGTCTA
 
. : . : . : . : . : . :
rJMFF017O03+ GTGTTGCCTCTCTCTATATGTTTCAGAGGAAGAACTATTTTGTCAAAGTCCTGCTTTGAT
JMFF017O03- GTGTTGCCTCTCTCTATATGTTTCAGAGGAAGAACTATTTTGTCAAAGTCCTGCTTTGAT
                      ____________________________________________________________
consensus GTGTTGCCTCTCTCTATATGTTTCAGAGGAAGAACTATTTTGTCAAAGTCCTGCTTTGAT
 
. : . : . : . : . : . :
rJMFF017O03+ ATATACTCCACAATTGTAGCATGAATCCATAATTAATAAACGTC
JMFF017O03- ATATACTCCACAATTGTAGCATGAAT-CATAATTAATAAACGTCTTTCTTGAATCGTTTA
                      ____________________________________________________________
consensus ATATACTCCACAATTGTAGCATGAATCCATAATTAATAAACGTCTTTCTTGAATCGTTTA