Previous Contig 000911:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017L15Sequence564000911 (6)gb:AP003766_18332247e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P000715000911 (6)gb:AP003766_18332241e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P000
JMFN006H10Sequence593000911 (6)gb:AP003766_18332248e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P000
JMFN010H23Sequence517000911 (6)gb:AP003766_18332247e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P000
JMFN034N06Sequence575000911 (6)gb:AP003766_18332248e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P000
JMFN036L16Sequence550000911 (6)gb:AP003766_18332247e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P000

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN010H23+ GAAGTTATAAGCTTTA
rJMFF017L15- TAAGCTTTA
                      ____________________________________________________________
consensus GAAGTTATAAGCTTTA
 
. : . : . : . : . : . :
JMFN010H23+ TTTTCAGCTAAAAGAATATTTCAACAATCACAGGATATTCTGTCTATATATATGCCAAAT
rJMFF017L15- TTTTCAGCTAAAAGAATATTTCAACAATCACAGGATATTCTGTCTATATATATGCCAAAT
                      ____________________________________________________________
consensus TTTTCAGCTAAAAGAATATTTCAACAATCACAGGATATTCTGTCTATATATATGCCAAAT
 
. : . : . : . : . : . :
JMFN010H23+ TCATATCAGAATTCACAAGTACAACACTGCACTGTTCTGCAAACAACACTCTGAGGTCTA
JMFN006H10+ GAGGTCTA
rJMFF017L15- TCATATCAGAATTCACAAGTACAACACTGCACTGTTCTGCAAACAACACTCTGAGGTCTA
                      ____________________________________________________________
consensus TCATATCAGAATTCACAAGTACAACACTGCACTGTTCTGCAAACAACACTCTGAGGTCTA
 
. : . : . : . : . : . :
JMFN010H23+ ACTGCTGCTCAGAAATACTACCTCCATGAAAACCTGCAACAGTTTAAACACAAAAACTCC
JMFN034N06+ TCAGAAATACTACCTCCATGAAAACCTGCAACAGTTTAAACACAAAAACTCC
JMFN036L16+ TTAAACACAAAAACTCC
JMFN006H10+ ACTGCTGCTCAGAAATACTACCTCCATGAAAACCTGCAACAGTTTAAACACAAAAACTCC
rJMFF017L15- ACTGCTGCTCAGAAATACTACCTCCATGAAAACCTGCAACAGTTTAAACACAAAAACTCC
JMFF017L15+ CAACAGTTTAAACACAAAAACTCC
                      ____________________________________________________________
consensus ACTGCTGCTCAGAAATACTACCTCCATGAAAACCTGCAACAGTTTAAACACAAAAACTCC
 
. : . : . : . : . : . :
JMFN010H23+ GAATCTACCACAGTATTATAGACGCCCCGAGCAATAGCAAGCTGGAAACTTCAGCCCATG
JMFN034N06+ GAATCTACCACAGTATTATAGACGCCCCGAGCAATAGCAAGCTGGAAACTTCAGCCCATG
JMFN036L16+ GAATCTACCACAGTATTATAGACGCCCCGAGCAATAGCAAGCTGGAAACTTCAGCCCATG
JMFN006H10+ GAATCTACCACAGTATTATAGACGCCCCGAGCAATAGCAAGCTGGAAACTTCAGCCCATG
rJMFF017L15- GAATCTACCACAGTATTATAGACGCCCCGAGCAATAGCAAGCTGGAAACTCCAGCCCATG
JMFF017L15+ GAATCTACCACAGTATTATAGACGCCCCGAGCAATAGCAAGCTGGAAACTCCAGCCCATG
                      ____________________________________________________________
consensus GAATCTACCACAGTATTATAGACGCCCCGAGCAATAGCAAGCTGGAAACTTCAGCCCATG
 
. : . : . : . : . : . :
JMFN010H23+ CAAACCTGCTTACTCCACTTGGTGTAGCTGGAGGCGGCTGCGGCACTGATGGAGGAGTGG
JMFN034N06+ CAAACCTGCTTACTCCACTTGGTGTAGCTGGAGGCGGCTGCGGCACTGATGGAGGAGTGG
JMFN036L16+ CAAACCTGCTTACTCCACTTGGTGTAGCTGGAGGCGGCTGCGGCACTGATGGAGGAGTGG
JMFN006H10+ CAAACCTGCTTACTCCACTTGGTGTAGCTGGAGGCGGCTGCGGCACTGATGGAGGAGTGG
rJMFF017L15- CAAGCCTGCTTACTCCACTTGGTGTAGCTGGAGGCGGCTGCGGCACTGATGGAGGAGTGG
JMFF017L15+ CAAGCCTGCTTACTCCACTTGGTGTAGCTGGAGGCGGCTGCGGCACTGATGGAGGAGTGG
                      ____________________________________________________________
consensus CAAACCTGCTTACTCCACTTGGTGTAGCTGGAGGCGGCTGCGGCACTGATGGAGGAGTGG
 
. : . : . : . : . : . :
JMFN010H23+ TATTAGTAGCGGCGGTTGGACTCAAAGCTTTGTCGCAGGCGCTGACGTCATTGCTTATAC
JMFN034N06+ TATTAGTAGCGGCGGTTGGACTCAAAGCTTTGTCGCAGGCGCTGACGTCATTGCTTATAC
JMFN036L16+ TATTAGTAGCGGCGGTTGGACTCAAAGCTTTGTCGCAGGCGCTGACGTCATTGCTTATAC
JMFN006H10+ TATTAGTAGCGGCGGTTGGACTCAAAGCTTTGTCGCAGGCGCTGACGTCATTGCTTATAC
rJMFF017L15- TATTAGTAGCGGCGGTTGGACTCAAAGCTTTGTCGCAGGCGCTGACGTCATTGCTTATAC
JMFF017L15+ TATTAGTAGCGGCGGTTGGACTCAAAGCTTTGTCGCAGGCGCTGACGTCATTGCTTATAC
                      ____________________________________________________________
consensus TATTAGTAGCGGCGGTTGGACTCAAAGCTTTGTCGCAGGCGCTGACGTCATTGCTTATAC
 
. : . : . : . : . : . :
JMFN010H23+ CGCAGTGCTTGGGAAGCTCAAGGGCCTGAGTGATGTTGACTCCGAGGGACTTCAACACTT
JMFN034N06+ CGCAGTGCTTGGGAAGCTCAAGGGCCTGAGTGATGTTGACTCCGAGGGACTTCAACACTT
JMFN036L16+ CGCAGTGCTTGGGAAGCTCAAGGGCCTGAGTGATGTTGACTCCGAGGGACTTCAACACTT
JMFN006H10+ CGCAGTGCTTGGGAAGCTCAAGGGCCTGAGTGATGTTGACTCCGAGGGACTTCAACACTT
rJMFF017L15- CGCAGTGCTTGGGAAGCTCAAGGGCCTGAGTGATGTTGACTCCGAGGGACTTCAACACTT
JMFF017L15+ CGCAGTGCTTGGGAAGCTCAAGGGCCTGAGTGATGTTGACTCCGAGGGACTTCAACACTT
                      ____________________________________________________________
consensus CGCAGTGCTTGGGAAGCTCAAGGGCCTGAGTGATGTTGACTCCGAGGGACTTCAACACTT
 
. : . : . : . : . : . :
JMFN010H23+ CCGGGTTCTTATAGAGGTTGCAGAGGCAACTGAGCTCTTTAGTCACGGTTTCTTTGAGCG
JMFN034N06+ CCGGGTTCTTATAGAGGTTGCAGAGGCAACTGAGCTCTTTAGTCACGGTTTCTTTGAGCG
JMFN036L16+ CCGGGTTCTTATAGAGGTTGCAGAGGCAACTGAGCTCTTTAGTCACGGTTTCTTTGAGCG
JMFN006H10+ CCGGGTTCTTATAGAGGTTGCAGAGGCAACTGAGCTCTTTAGTCACGGTTTCTTTGAGCG
rJMFF017L15- CCGGGTTCTTATAGAGGTTGCAGAGGCAACTGAGCTCTTTAGTCACGGTTTCTTTGAGCG
JMFF017L15+ CCGGGTTCTTATAGAGGTTGCAGAGGCAACTGAGCTCTTTAGTCACGGTTTCTTTGAGCG
                      ____________________________________________________________
consensus CCGGGTTCTTATAGAGGTTGCAGAGGCAACTGAGCTCTTTAGTCACGGTTTCTTTGAGCG
 
. : . : . : . : . : . :
JMFN010H23+ GGTCGCAGCAGGAGGCGGGCG
JMFN034N06+ GGTCGCAGCAGGAGGCGGGCGGTTTGGTGGAGTTGAGGTACTCAGCGCAGGGGACGAGGT
JMFN036L16+ GGTCGCAGCAGGAGGCGGGCGGTTTGGTGGAGTTGAGGTACTCAGCGCAGGGGACGAGGT
JMFN006H10+ GGTCGCAGCAGGAGGCGGGCGGTTTGGTGGAGTTGAGGTACTCAGCGCAGGGGACGAGGT
rJMFF017L15- GGTCGCAGCAGGAGGCGGGCGGTTTGGTGGAGTTGAGGTACTCAGCGCAGGGGACGAGGT
JMFF017L15+ GGTCGCAGCAGGAGGCGGGCGGTTTGGTGGAGTTGAGGTACTCAGCGCAGGGGACGAGGT
                      ____________________________________________________________
consensus GGTCGCAGCAGGAGGCGGGCGGTTTGGTGGAGTTGAGGTACTCAGCGCAGGGGACGAGGT
 
. : . : . : . : . : . :
JMFN034N06+ TGGAAGCGCAGGAGGTGGACTGGGCGGTGGCGGTGGCCGTCAACATTAGCACCGCCGCTA
JMFN036L16+ TGGAAGCGCAGGAGGTGGACTGGGCGGTGGCGGTGGCCGTCAACATTAGCACCGCCGCCA
JMFN006H10+ TGGAAGCGCAGGAGGTGGACTGGGCGGTGGCGGTGGCCGTCAACATTAGCACCGCCGCTA
rJMFF017L15- TGGAAGCGCAGGAGGTGGACTGGGCGGTGGCGGTGGCCGTCAACATTAGCACCGCCGCTA
JMFF017L15+ TGGAAGCGCAGGAGGTGGACTGGGCGGTGGCGGTGGCCGTCAACATTAGCACCGCCGCTA
                      ____________________________________________________________
consensus TGGAAGCGCAGGAGGTGGACTGGGCGGTGGCGGTGGCCGTCAACATTAGCACCGCCGCTA
 
. : . : . : . : . : . :
JMFN034N06+ GCGCCGCGATCGCCGTCGCCAGCATTTTGGTGGAAGCCATGTTAAGCTTAGCGTAGAAGA
JMFN036L16+ CCCCCGCGATTGCCGTCGCCAGCATTTTGGTGGAAGCCATGTTAAGCTTAGCGTAGAAGA
JMFN006H10+ GCGCCGCGATCGCCGTCGCCAGCATTTTGGTGGAAGCCATGTTAAGCTTAGCGTAGAAGA
rJMFF017L15- GCGCCGCGATCGCCGTCGCCAGCATTTTGGTGGAAGCCATGTTAAGCTTAGCGTAGAAGA
JMFF017L15+ GCGCCGCGATCGCCGTCGCCAGCATTTTGGTGGAAGCCATGTTAAGCTTAGCGTAGAAGA
                      ____________________________________________________________
consensus GCGCCGCGATCGCCGTCGCCAGCATTTTGGTGGAAGCCATGTTAAGCTTAGCGTAGAAGA
 
. : . : . : . : . : . :
JMFN034N06+ AACTAGACTCTCTCTTCTCGATCGGAATGGGCTGCGCCTTTGT
JMFN036L16+ AACTAGACTCTCTCTTCTCGATCGGAATGGGCTGCGCCTTTGTGA
JMFN006H10+ AACTAGACTCTCTCTTCTCGATCGGAATGGGCTGCGCCTTTGTGA
rJMFF017L15- AACTAAACTCTCTCTTCTCGATCGGAATGGGCTGCGCCTTTGTGA
JMFF017L15+ AACTAGACTCTCTCTTCTCGATCGGAATGGGCTGCGCCTTTGTGAGCTGTACGGGCTTGT
                      ____________________________________________________________
consensus AACTAGACTCTCTCTTCTCGATCGGAATGGGCTGCGCCTTTGTGAGCTGTACGGGCTTGT