Previous Contig 000906:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017J21Sequence637000906 (3)gb:AC146506_17445933e-47Solanum demissum chromosome 5 BAC PGEC989P08 genomic sequence, complete sequence633000906 (3)gb:AC146506_17445933e-47Solanum demissum chromosome 5 BAC PGEC989P08 genomic sequence, complete sequence
JMFN005J04Sequence586000906 (3)gb:AC146506_17445933e-47Solanum demissum chromosome 5 BAC PGEC989P08 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN005J04+ ATCA
                      ____________________________________________________________
consensus ATCA
 
. : . : . : . : . : . :
JMFN005J04+ AAATCAATATGATGTATAATTGTGGGATCAAATTAACAAAAGCGACACAGCATCAAACCA
                      ____________________________________________________________
consensus AAATCAATATGATGTATAATTGTGGGATCAAATTAACAAAAGCGACACAGCATCAAACCA
 
. : . : . : . : . : . :
JMFN005J04+ TTTAACTTAGAATGACAGGTTCTATATAGTTCTTCCTAACAGAAAAGCAAATTGGAAAGT
                      ____________________________________________________________
consensus TTTAACTTAGAATGACAGGTTCTATATAGTTCTTCCTAACAGAAAAGCAAATTGGAAAGT
 
. : . : . : . : . : . :
JMFN005J04+ ATTGCAACAACCACTTGGCTGTGCACAATTTGTAACAATCTCAATTCCTAAATTTTTCTG
                      ____________________________________________________________
consensus ATTGCAACAACCACTTGGCTGTGCACAATTTGTAACAATCTCAATTCCTAAATTTTTCTG
 
. : . : . : . : . : . :
JMFN005J04+ AAACACGTAATCTGAATTCTAAGGATCGCAATTTCAGTTCTTGCCAGCTTGCTTTTCTTT
rJMFF017J21- TTCAGTTCTTGCCAGCTTGCTTTTCTTT
JMFF017J21+ TTCAGTTCTTGCCAGCTTGCTTTTCTTT
                      ____________________________________________________________
consensus AAACACGTAATCTGAATTCTAAGGATCGCAATTTCAGTTCTTGCCAGCTTGCTTTTCTTT
 
. : . : . : . : . : . :
JMFN005J04+ TGCTTTTTGGATCTTCAAAACTTTCTTCACAATCTTCTGCTCTTCTACCAAGAAAGCTCG
rJMFF017J21- TGCTTTTTGGATCTTCAAAACTTTCTTCACAATCTTCTGCTCTTCTACCAAGAAAGCTCG
JMFF017J21+ TGCTTTTTGGATCTTCAAAACTTTCTTCACAATCTTCTGCTCTTCTACCAAGAAAGCTCG
                      ____________________________________________________________
consensus TGCTTTTTGGATCTTCAAAACTTTCTTCACAATCTTCTGCTCTTCTACCAAGAAAGCTCG
 
. : . : . : . : . : . :
JMFN005J04+ AATAATCCTCTCTCTCACAGCCCCACCAGACAATACACCACCATAGGGTCGGTTAACAGT
rJMFF017J21- AATAATCCTCTCTCTCACAGCCCCACCAGACAATACACCACCATAGGGTCGGTTAACAGT
JMFF017J21+ AATAATCCTCTCTCTCACAGCCCCACCAGACAATACACCACCATAGGGTCGGTTAACAGT
                      ____________________________________________________________
consensus AATAATCCTCTCTCTCACAGCCCCACCAGACAATACACCACCATAGGGTCGGTTAACAGT
 
. : . : . : . : . : . :
JMFN005J04+ TCTCCTATTCCTAGGTAATCTGGACCTCTTGTACTCAGCAGGTCTCAAGTGCGGGATCCC
rJMFF017J21- TCTCCTATTCCTAGGTAATCTGGACCTCTTGTACTCAGCAGGTCTCAAGTGCGGGATCCC
JMFF017J21+ TCTCCTATTCCTAGGTAATCTGGACCTCTTGTACTCAGCAGGTCTCAAGTGCGGGATCCC
                      ____________________________________________________________
consensus TCTCCTATTCCTAGGTAATCTGGACCTCTTGTACTCAGCAGGTCTCAAGTGCGGGATCCC
 
. : . : . : . : . : . :
JMFN005J04+ TTGAATCCTCTTCCCAGTAACAGGACACTTTGGTCCACTAGCCCTCTTCTTCGTGGTCTG
rJMFF017J21- TTGAATCCTCTTCCCAGTAACAGGACACTTTGGTCCACTAGCCCTCTTCTTCGTGGTCTG
JMFF017J21+ TTGAATCCTCTTCCCAGTAACAGGACACTTTGGTCCACTAGCCCTCTTCTTCGTGGTCTG
                      ____________________________________________________________
consensus TTGAATCCTCTTCCCAGTAACAGGACACTTTGGTCCACTAGCCCTCTTCTTCGTGGTCTG
 
. : . : . : . : . : . :
JMFN005J04+ ATACACCAGCTTCCCACCAGGGGTTTTCACGACGCGGTGCTGGTTGGACTTGGTGGCATA
rJMFF017J21- ATACACCAGCTTCCCACCAGGGGTTTTCACGACGCGGTGCTGGTTGGACTTGGTGGCATA
JMFF017J21+ ATACACCAGCTTCCCACCAGGGGTTTTCACGACGCGGTGCTGGTTGGACTTGGTGGCATA
                      ____________________________________________________________
consensus ATACACCAGCTTCCCACCAGGGGTTTTCACGACGCGGTGCTGGTTGGACTTGGTGGCATA
 
. : . : . : . : . : . :
JMFN005J04+ GCTATGGCGTTTCCGGTAAGTGAGACGCTGCACCAT
rJMFF017J21- GCTATGGCGTTTCCGGTAAGTGAGACGCTGCACCATCTTCGGAACTCCTTCCGGCCTCCG
JMFF017J21+ GCTATGGCGTTTCCGGTAAGTGAGACGCTGCACCATCTTCGGAACTCCTTCCGGCCTCCG
                      ____________________________________________________________
consensus GCTATGGCGTTTCCGGTAAGTGAGACGCTGCACCATCTTCGGAACTCCTTCCGGCCTCCG
 
. : . : . : . : . : . :
rJMFF017J21- CAATACAGATAGAAGCTGAAGAGAGGAGGCTAGGAAGCAGGTTAACTGTAAAGTGTAAAG
JMFF017J21+ CAATACAGATAGAAGCTGAAGAGAGGAGGCTAGGAAGCAGGTTAACTGTAAAGTGTAAAG
                      ____________________________________________________________
consensus CAATACAGATAGAAGCTGAAGAGAGGAGGCTAGGAAGCAGGTTAACTGTAAAGTGTAAAG