Previous Contig 000902:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001K18Sequence183000902 (5)711012975 (6)gb:AY098525_15764423e-16Ananas comosus putative ATP/GTP binding protein mRNA, complete cds.
JMFF017I12Sequence584000902 (5)gb:OSJN00056_16940281e-14Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0015K02, complete seque658012975 (6)gb:AY098525_15764429e-16Ananas comosus putative ATP/GTP binding protein mRNA, complete cds.
JMFF024M04Sequence503000902 (5)gb:OSJN00056_16940280.002Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0015K02, complete seque784012975 (6)gb:AY098525_15764423e-20Ananas comosus putative ATP/GTP binding protein mRNA, complete cds.
JMSF018O17Sequence318000902 (5)gb:AB016893_15132682e-23Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYH9.743012975 (6)gb:AY098525_15764423e-34Ananas comosus putative ATP/GTP binding protein mRNA, complete cds.
JMSF035G03Sequence644000902 (5)gb:AB016893_15132681e-26Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYH9.707012975 (6)gb:AY098525_15764427e-15Ananas comosus putative ATP/GTP binding protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018O17+ ACAGCAACCACAACTGGTATGCATGTAACTTTTG
                      ____________________________________________________________
consensus ACAGCAACCACAACTGGTATGCATGTAACTTTTG
 
. : . : . : . : . : . :
JMSF018O17+ CTTGACCTTGGTATGAGACCAATTGTGGTTCTGTAAAGCCAAAAAGGTAGACGTTTTTTC
JMSF035G03+ GGTATGAGACCAATTGTGGTTCTGTACAGCCAAAAAGGTAGACTTTTTTTC
                      ____________________________________________________________
consensus CTTGACCTTGGTATGAGACCAATTGTGGTTCTGTACAGCCAAAAAGGTAGACTTTTTTTC
 
. : . : . : . : . : . :
JMSF018O17+ CATATAACTTTCCGCCTTCTTCAAAGGCTTCCTCCAGATTTGAGAAGTTCCATTTATACT
JMSF035G03+ CATATAACTTTCCGCCTTCTTCAAAGGCTTCCTCCAGATTTGAGAAGTTCCATTTATACT
JMFF017I12+ TTCTTCAAAGGCTTCCTCCAGATTTGAGAAGTTCCATTTATACT
                      ____________________________________________________________
consensus CATATAACTTTCCGCCTTCTTCAAAGGCTTCCTCCAGATTTGAGAAGTTCCATTTATACT
 
. : . : . : . : . : . :
JMSF018O17+ GATAGACCATGTCCAACTGATCCCACTCAGTACCAACTGGGAAAACTTGCTTACATAGAT
JMSF035G03+ GATAGACCATGTCCAACTGATCCCACTCAGTACCAACAGGGAAAACTTGTTGCCATAGAT
JMFF024M04+ AGGGAAAACTTGTTGCCATAGAT
JMFF017I12+ GATAGACCATGTCCAACTGATCCCACTCAGTACCAACAGGGAAAACTTGTTGCCATAGAT
                      ____________________________________________________________
consensus GATAGACCATGTCCAACTGATCCCACTCAGTACCAACAGGGAAAACTTGTTGCCATAGAT
 
. : . : . : . : . : . :
JMSF018O17+ CCTCC
JMSF035G03+ CCTCCAAATTGCGCTTCTCGGGGAAGTACTCGGTTTCAGTGTCCTGTTTGGAAGTCCTAG
JMFF024M04+ CCTCCAAATTGCGCTTCTCGGGGAAGTACTCGGTTTCAGTGTCCTGTTTGGAAGTCCTAG
JMFF017I12+ CCTCCAAATTGCGCTTCTCGGGGAAGTACTCGGTTTCAGTGTCCTGTTTGGAAGTCCTAG
                      ____________________________________________________________
consensus CCTCCAAATTGCGCTTCTCGGGGAAGTACTCGGTTTCAGTGTCCTGTTTGGAAGTCCTAG
 
. : . : . : . : . : . :
JMSF035G03+ CTCGTTTAGCTCGAGGCTTGGTAGGTTTTTTGCTGGGCTCGCCCTCAGCCAAAGACTTGC
JMFF024M04+ CTCGTTTAGCTCGAGGCTTGGTAGGTTTTTTGCTGGGCTCGCCCTCAGCCAAAGACTTGC
JMFF017I12+ CTCGTTTAGCTCGAGGCTTGGTAGGTTTTTTGCTGGGCTCGCCCTCAGCCAAAGACTTGC
                      ____________________________________________________________
consensus CTCGTTTAGCTCGAGGCTTGGTAGGTTTTTTGCTGGGCTCGCCCTCAGCCAAAGACTTGC
 
. : . : . : . : . : . :
JMSF035G03+ TAGGCTCTTCCTTGTCACTGTCCTCCTGAGCAGCAGATTGGCTCTGCTCCTCCGCCGACT
JMFF024M04+ TAGGCTCTTCCTTGTCATTGTCCTCCTGAGCAGCAGATTGGCTCTGCTCCTCCGCCGACT
JMFF017I12+ TAGGCTCTTCCTTGTCATTGTCCTCCTGAGCAGCAGATTGGCTCTGCTCCTCCGCCGACT
                      ____________________________________________________________
consensus TAGGCTCTTCCTTGTCATTGTCCTCCTGAGCAGCAGATTGGCTCTGCTCCTCCGCCGACT
 
. : . : . : . : . : . :
JMSF035G03+ GGCTAGGCTCCGGCTCCGGTTCGTTTTCCTTCTCTTCCGCGGATTTGCTCTGCTGCTTCC
JMFF024M04+ GGCTAGGCTCCGGCTCCGGTTCGTTTTCCTTCTCTTCCGCGGATTTGCTCTGCTGCTTCC
JMFF017I12+ GGCTAGGCTCCGGCTCCGGTTCGTTTTCCTTCTCTTCCGCGGATTTGCTCTGCTGCTTCC
                      ____________________________________________________________
consensus GGCTAGGCTCCGGCTCCGGTTCGTTTTCCTTCTCTTCCGCGGATTTGCTCTGCTGCTTCC
 
. : . : . : . : . : . :
JMSF035G03+ TCTTCGTGGTCTTCTTCTCCTTCGCCTCCGCAGGAGCTTTGTCCTTCTGGCTCCCCTTTC
JMFF024M04+ TCTTCGTGGTCTTCTTCTCCTTCGCCTCCGCAGGAGCTTTGTCCTTCTGGCTCCCCTTTC
JMFF001K18+ TTC
JMFF017I12+ TCTTCGTGGTCTTCTTCTCCTTCGCCTCCGCAGGAGCTTTGTCCTTCTGGCTCCCCTTTC
                      ____________________________________________________________
consensus TCTTCGTGGTCTTCTTCTCCTTCGCCTCCGCAGGAGCTTTGTCCTTCTGGCTCCCCTTTC
 
. : . : . : . : . : . :
JMSF035G03+ TCTTTGCACCTCTCTTCATTGTCGATATAGAGAGAGAAAGTGTGTGTGTCTGTATCTGAG
JMFF024M04+ TCTTTGCACCTCTCTTCATTGTCGATATAGAGAGAGAAAGTGTGTGTGTCTGTATCTGAG
JMFF001K18+ TCTTTGCACCTCTCTTCATTGTCGATATAGAGAGAGAAAGTGTGTGTGTCTGTATCTGAG
JMFF017I12+ TCTTTGCACCTCTCTTCATTGTCGATATAGAGAGAGAAAGTGTGTGTGTCTGTATCTGAG
                      ____________________________________________________________
consensus TCTTTGCACCTCTCTTCATTGTCGATATAGAGAGAGAAAGTGTGTGTGTCTGTATCTGAG
 
. : . : . : . : . : . :
JMSF035G03+ TGTAGATATAGAGAGAGAAGGGTTTGATTGAAGGGTTGTAGAAGAGAGGGGGTTAGTTGG
JMFF024M04+ TGTAGATATAGAGAGAGAAGGGTTTGATTGAAGGGTTGTAGAAGAGAGGGGGTTAGTTGG
JMFF001K18+ TGTAGATATAGAGAGAGAAGGGTTTGATTGAAGGGTTGTAGAAGAGAGGGGGTTAGTTGG
JMFF017I12+ TGTAGATATAGAGAGAGAAGGGTTTGATTGAAGGGTTGTAGAAGAGAGGGGGTTAGTTGG
                      ____________________________________________________________
consensus TGTAGATATAGAGAGAGAAGGGTTTGATTGAAGGGTTGTAGAAGAGAGGGGGTTAGTTGG
 
. : . : . : . : . : . :
JMSF035G03+ CTGCGAGCTGCGAATTTGAATTGGAAAGGGCTAAAATGAGATGGCGGAAACC
JMFF024M04+ CTGCGAGCTGCGAATTTGAATTGGAAAGGGCTAAAATGAGATGGCGGAAACC
JMFF001K18+ CTGCGAGCTGCGAATTTGAATTGGAAAGGGCTAAAATGAGATGGCGGAAACC
JMFF017I12+ CTGCGAGCTGCGAATTTGAATTGGAAAGGGCTAAAATGAGATGGCGGAAACCGGAAAGTG
                      ____________________________________________________________
consensus CTGCGAGCTGCGAATTTGAATTGGAAAGGGCTAAAATGAGATGGCGGAAACCGGAAAGTG