Previous Contig 000882:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017E15Sequence592000882 (7)pir|T07928|T079284e-57probable long-chain-fatty-acid-CoA ligase (EC 6.2.1.3) isoform 1 - rape>gb:BNACO690010955 (7)pir|G96530|G965306e-54probable acyl CoA synthetase [imported] - Arabidopsis thaliana>gb:AE005173_89287
JMFF039F19Sequence512000882 (7)pir|T07928|T079282e-48probable long-chain-fatty-acid-CoA ligase (EC 6.2.1.3) isoform 1 - rape>gb:BNACO646010955 (7)pir|G96530|G965309e-64probable acyl CoA synthetase [imported] - Arabidopsis thaliana>gb:AE005173_89287
JMFF050A24Sequence586000882 (7)pir|T07928|T079288e-57probable long-chain-fatty-acid-CoA ligase (EC 6.2.1.3) isoform 1 - rape>gb:BNACO618010955 (7)pir|G96530|G965303e-50probable acyl CoA synthetase [imported] - Arabidopsis thaliana>gb:AE005173_89287
JMFS037B07Sequence608000882 (7)pir|T07928|T079286e-48probable long-chain-fatty-acid-CoA ligase (EC 6.2.1.3) isoform 1 - rape>gb:BNACO
JMFS074B04Sequence623000882 (7)pir|T07928|T079282e-67probable long-chain-fatty-acid-CoA ligase (EC 6.2.1.3) isoform 1 - rape>gb:BNACO
JMSF012G07Sequence244000882 (7)pir|G96530|G965303e-16probable acyl CoA synthetase [imported] - Arabidopsis thaliana>gb:AE005173_89287720010955 (7)pir|G96530|G965301e-80probable acyl CoA synthetase [imported] - Arabidopsis thaliana>gb:AE005173_89287
JMSF014P16Sequence461000882 (7)pir|T07928|T079286e-47probable long-chain-fatty-acid-CoA ligase (EC 6.2.1.3) isoform 1 - rape>gb:BNACO781022632gb:AY587773_16165003e-32Tamarix androssowii putative stress-responsive protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS074B04+ AAAGCAAGCTACACCGAGTTCTTCAGCTTCCTTTCTCTTCTCGGTGG
                      ____________________________________________________________
consensus AAAGCAAGCTACACCGAGTTCTTCAGCTTCCTTTCTCTTCTCGGTGG
 
. : . : . : . : . : . :
JMFS074B04+ AAATATTTCCAAAGCTTACAATAGTTTTCAGATGTGAAATACATCTCGGCAAGCACGTTA
                      ____________________________________________________________
consensus AAATATTTCCAAAGCTTACAATAGTTTTCAGATGTGAAATACATCTCGGCAAGCACGTTA
 
. : . : . : . : . : . :
JMFS074B04+ ATATAGCCGGTATCTTGTTCTCTTGAACAAACGCTATTGACAGCTCAGCATGGTTTATGA
JMFF039F19+ ACAAACGCTATTGACAGCTCAGCATGGTTTATGA
                      ____________________________________________________________
consensus ATATAGCCGGTATCTTGTTCTCTTGAACAAACGCTATTGACAGCTCAGCATGGTTTATGA
 
. : . : . : . : . : . :
JMFS074B04+ TGAACTCCACTGCATTTGCGCCAAGTGTATCATATAATGGTACATAGGAAATGGCTTGGC
JMSF014P16+ CGCCAAGTGTATCATATAATGGTACATAGGAAATGGCTTGGC
JMFF039F19+ TGAACTCCACTGCATTTGCGCCAAGTGTATCATATAATGGTACATAGGAAATGGCTTGGC
                      ____________________________________________________________
consensus TGAACTCCACTGCATTTGCGCCAAGTGTATCATATAATGGTACATAGGAAATGGCTTGGC
 
. : . : . : . : . : . :
JMFS037B07+ CCTCCATTGCCATTATCCATTCCGGAGAGTTAGTACCATATATGCCACACT
JMFS074B04+ TGTTGCAAGCCTCCATTGCCATTATCCATTCCGGAGAGTTAGTACCATATATGCCACACT
JMSF014P16+ TGTTGCAAGCCTCCATTGCCATTATCCATTCCGGAGAGTTAGTACCATATATGCCACACT
JMFF050A24+ CCTCCATTGCCATTATCCATTCCGGAGAGTTAGTACCATATATGCCACACT
JMFF039F19+ TGTTGCAAGCCTCCATTGCCATTATCCATTCCGGAGAGTTAGTACCATATATGCCACACT
JMFF017E15+ CCTCCATTGCCATTATCCATTCCGGAGAGTTAGTACCATATATGCCACACT
                      ____________________________________________________________
consensus TGTTGCAAGCCTCCATTGCCATTATCCATTCCGGAGAGTTAGTACCATATATGCCACACT
 
. : . : . : . : . : . :
JMFS037B07+ TATCACCAGGGTTGACACCGCATTTTCGGATAGCAGAGCCAA-TTTTTTTGGCAGTATTG
JMFS074B04+ TATCACCAGGGTTGACACCGCATTTTCGGATAGCAGAGCCAA-TTTTTTTGGCAGTATTG
JMSF014P16+ TATCACCAGGGTTGACACCGCATTTTCGGATAGCAGAGCCAA-TTTTTTTGGCAGTATTG
JMFF050A24+ TATCACCAGGGTTGACACCGCATTTTCGGATAGCAGAGCCAATTTTTTTTGGCAGTATTG
JMFF039F19+ TATCACCAGGGTTGACACCGCATTTTCGGATAGCAGAGCCAA-TTTTTTTGGCAGTATTG
JMFF017E15+ TATCACCAGGGTTGACACCGCATTTTCGGATAGCAGAGCCAA-TTTTTTTGGCAGTATTG
                      ____________________________________________________________
consensus TATCACCAGGGTTGACACCGCATTTTCGGATAGCAGAGCCAA-TTTTTTTGGCAGTATTG
 
. : . : . : . : . : . :
JMFS037B07+ TAAGACTCTTCATATGTCATCCAGACATAGGAACCTGCCTTCTTGTCAGTAATCTGACGG
JMFS074B04+ TAAGACTCTTCATATGTCATCCAGACATAGGAACCTGCCTTCTTGTCAGTAATCTGACGG
JMSF014P16+ TAAGACTCTTCATATGTCATCCAGACATAGGAACCTGCCTTCTTGTCAGTAATCTGACGG
JMFF050A24+ TAAGACTCTTCATATGTCATCCAGACATAGGAACCTGCCTTCTTGTCAGTAATCTGACGG
JMFF039F19+ TAAGACTCTTCATATGTCAT-CAGACATAGGAACCTGCCTTCTTGTCAGTAATCTGACGG
JMFF017E15+ TAAGACTCTTCATATGTCAT-CAGACATAGGAACCTGCCTTCTTGTCAGTAATCTGACGG
                      ____________________________________________________________
consensus TAAGACTCTTCATATGTCATCCAGACATAGGAACCTGCCTTCTTGTCAGTAATCTGACGG
 
. : . : . : . : . : . :
JMFS037B07+ CGACCAAGCATCGGGTTTTTTGGGTATTTCTTGACAGAGTTACTGAAGAAGTCCCAGGGA
JMFS074B04+ CGACCAAGCATCGGGTTTTTTGGGTATTTCTTGACAGAGTTACTGAAGAAGTCCCAGGGA
JMSF014P16+ CGACCAAGCATCGGGTTTTTTGGGTATTTCTTGACAGAGTTACTGAAGAAGTCCCAGGGA
JMFF050A24+ CGACCAAGCATCGGGTTTTTTGGGTATTTCTTGACAGAGTTACTGAAGAAGTCCCAGGGA
JMSF012G07+ GACCAAGCATCGGGTTTTTTGGGTATTTCTTGACAGAGTTACTGAAGAAGTCCCAGGGA
JMFF039F19+ CGACCAAGCATCGGGTTTTTTGGGTATTTCTTGACAGAGTTACTGAAGAAGTCCCAGGGA
JMFF017E15+ CGACCAAGCATCGGGTTTTTTGGGTATTTCTTGACAGAGTTACTGAAGAAGTCCCAGGGA
                      ____________________________________________________________
consensus CGACCAAGCATCGGGTTTTTTGGGTATTTCTTGACAGAGTTACTGAAGAAGTCCCAGGGA
 
. : . : . : . : . : . :
JMFS037B07+ GACTCCAATCCAGCAGGCATTTCCATGAGAGCATCTTTAGCATAAATGCACCTATACACA
JMFS074B04+ GACTCCAATCCAGCAGGCATTTCCATGAGAGCATCTTTAGCATAAATGCACCTATACACA
JMSF014P16+ GACTCCAATCCAGCAGGCATTTCCATGAGAGCATCTTTAGCATAAATGCACCTATACACA
JMFF050A24+ GACTCCAATCCAGCAGGCATTTCCATGAGAGCATCTTTAGCATAAATGCACCTATACACA
JMSF012G07+ GACTCCAATCCAGCAGGCATTTCCATGAGAGCATCTTTAGCATAAATGCACCTATACACA
JMFF039F19+ GACTCCAATCCAGCAGGCATTTCCATGAGAGCATCTTTAGCATAAATGCACCTATACACA
JMFF017E15+ GACTCCAATCCAGCAGGCATTTCCATGAGAGCATCTTTAGCATAAATGCACCTATACACA
                      ____________________________________________________________
consensus GACTCCAATCCAGCAGGCATTTCCATGAGAGCATCTTTAGCATAAATGCACCTATACACA
 
. : . : . : . : . : . :
JMFS037B07+ GGTCCTGCAGACGGCTTCCCATCCCCAGCAGGCTTACCTTCTTCAACTTTCACCACATAA
JMFS074B04+ GGTCCTGCAGACGGCTTCCCATCCCCAGCAGGCTTACCTTCTTCAACTTTCACCACATAA
JMSF014P16+ GGTCCTGCAGACGGCTTCCCATCCCCAGCAGGCTTACCTTCTTCAACTTTCACCACATAA
JMFF050A24+ GGTCCTGCAGACGGCTTCCCATCCCCAGCAGGCTTACCTTCTTCAACTTTCACCACATAA
JMSF012G07+ GGTCCTGCAGACGGCTTCCCATCCCCAGCAGGCTTACCTTCTTCAACTTTCACCACATAA
JMFF039F19+ GGTCCTGCAGACGGCTTCCCATCCCCAGCAGGCTTACCTTCTTCAACTTTCACCACATAA
JMFF017E15+ GGTCCTGCAGACGGCTTCCCATCCCCAGCAGGCTTACCTTCTTCAACTTTCACCACATAA
                      ____________________________________________________________
consensus GGTCCTGCAGACGGCTTCCCATCCCCAGCAGGCTTACCTTCTTCAACTTTCACCACATAA
 
. : . : . : . : . : . :
JMFS037B07+ T
JMFS074B04+ TCTGCCATTTCAGCCTCAAAATCAGAAAACCAGAAAA
JMSF014P16+ TCTGCCATTTCAGCCTCAAAATCAGAAAACCAGAAAACTGGGTTCTACCAAAAGTCCACC
JMFF050A24+ TCTGCCATTTCAGCCTCAAAATCAGAAAACCAGAAAACTGGGTTCTACCAAAAGTCCACC
JMSF012G07+ TCTGCCATTTCAGCCTCAAAATCAGAAAACCAGAAAACTGGGTTCTACCAAAAGTCCAC
JMFF039F19+ TCTGCCATTTCAGCCTCAAAATCAGAAAACCAGAAAACTGGGTTCTACCAAAAGTCCACC
JMFF017E15+ TCTGCCATTTCAGCCTCAAAATCAGAAATCCAGAAAACTGGGTTCTACCAAAAGTTCACC
                      ____________________________________________________________
consensus TCTGCCATTTCAGCCTCAAAATCAGAAAACCAGAAAACTGGGTTCTACCAAAAGTCCACC