Previous Contig 000876:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017D09Sequence321000876 (3)294000876 (3)
JMSF046C24Sequence282020341820000876 (3)pir|T01128|T011286e-84hypothetical protein At2g23390 [imported] - Arabidopsis thaliana>gb:AC003040_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF046C24+ AAAAACTTTGATGAATTTTTGAT
                      ____________________________________________________________
consensus AAAAACTTTGATGAATTTTTGAT
 
. : . : . : . : . : . :
rJMSF046C24+ GGACATGAAGCAAAGTAAAAGGAAAAAATNTTCGTCAAGAGCGCAAGAAGATTTTTTCGC
                      ____________________________________________________________
consensus GGACATGAAGCAAAGTAAAAGGAAAAAATNTTCGTCAAGAGCGCAAGAAGATTTTTTCGC
 
. : . : . : . : . : . :
rJMSF046C24+ AAAATCTGACCATGAAGCGCTTAAGAGGATATGAAATCAAGGCTAAGCACTGGGATACAT
                      ____________________________________________________________
consensus AAAATCTGACCATGAAGCGCTTAAGAGGATATGAAATCAAGGCTAAGCACTGGGATACAT
 
. : . : . : . : . : . :
rJMSF046C24+ TCTATCAGTTCTACAGGAATACAACAGACAACAAGTGGGGTAGTGCCTATTTAACAAGAG
                      ____________________________________________________________
consensus TCTATCAGTTCTACAGGAATACAACAGACAACAAGTGGGGTAGTGCCTATTTAACAAGAG
 
. : . : . : . : . : . :
rJMSF046C24+ ATTTCTTTCACCATATGGGTTCAAAGATGGGTGATCAAGTAATGCTTATTGTTGCTGAAG
                      ____________________________________________________________
consensus ATTTCTTTCACCATATGGGTTCAAAGATGGGTGATCAAGTAATGCTTATTGTTGCTGAAG
 
. : . : . : . : . : . :
rJMSF046C24+ ACGGAGATGAGCTTGTTGCTGGAGCTCTTAATCTTATTGGAGGAGATACATTGTACGGGC
                      ____________________________________________________________
consensus ACGGAGATGAGCTTGTTGCTGGAGCTCTTAATCTTATTGGAGGAGATACATTGTACGGGC
 
. : . : . : . : . : . :
rJMSF046C24+ GCTTGTGGGGATGCCTTCCAGAAGCCTATTACCCAAACTTGCATTTCGAAGCTTGCTACT
                      ____________________________________________________________
consensus GCTTGTGGGGATGCCTTCCAGAAGCCTATTACCCAAACTTGCATTTCGAAGCTTGCTACT
 
. : . : . : . : . : . :
rJMSF046C24+ ACCAGGCCATTGAAGCAGCAATAGAGCTTAATCTTCAAACAGTTGAGGCAGGAGCTCAGG
                      ____________________________________________________________
consensus ACCAGGCCATTGAAGCAGCAATAGAGCTTAATCTTCAAACAGTTGAGGCAGGAGCTCAGG
 
. : . : . : . : . : . :
rJMSF046C24+ GTGAACATAAAATCCAAAGGGGATATCTGCCAGTCACTACTTACAGCAGTCATTATCTTG
                      ____________________________________________________________
consensus GTGAACATAAAATCCAAAGGGGATATCTGCCAGTCACTACTTACAGCAGTCATTATCTTG
 
. : . : . : . : . : . :
rJMSF046C24+ TGGATGAAGAGTTCAGGGATGTCATTACCGATTTCTTGGTGCGAGAAGCTGCTCAGCTTA
rJMFF017D09+ TGCGAGAAGCTGCTCAGCTTA
JMFF017D09- TGCGAGAAGCTGCTCAGCTTA
                      ____________________________________________________________
consensus TGGATGAAGAGTTCAGGGATGTCATTACCGATTTCTTGGTGCGAGAAGCTGCTCAGCTTA
 
. : . : . : . : . : . :
rJMSF046C24+ AACTTGTGATGAAGCTATTACACGATTCAGGTCCCTTCAAGGACGATCTGGAGCTGAAGT
rJMFF017D09+ AACTTGTGATGAAGCTATTACACGATTCAGGTCCCTTCAGGGACGATCTGGAGCTGAAGT
JMFF017D09- AACTTGTGATGAAGCTATTACACGATTCAGGTCCCTTCAGGGACGATCTGGAGCTGAAGT
                      ____________________________________________________________
consensus AACTTGTGATGAAGCTATTACACGATTCAGGTCCCTTCAGGGACGATCTGGAGCTGAAGT
 
. : . : . : . : . : . :
rJMSF046C24+ AAGGATTTTCCCTTAGTAGTCTCCGGGGATGATAAAGGTCAGGCCACTAAAAGCAAACTA
rJMFF017D09+ AAGGATTTTCCCTTAGTAGTCTCCGGGGATGATAAAGGTCAGGCCACTAAAAGCAAACTA
JMFF017D09- AAGGATTTTCCCTTAGTAGTCTCCGGGGATGATAAAGGTCAGGCCACTAAAAGCAAACTA
                      ____________________________________________________________
consensus AAGGATTTTCCCTTAGTAGTCTCCGGGGATGATAAAGGTCAGGCCACTAAAAGCAAACTA
 
. : . : . : . : . : . :
rJMSF046C24+ CTCTTGGCTGCTTATACTGTACATATAATTAACGTCAAGATGTTTGGGGGAGGGGGAGTG
rJMFF017D09+ CTCTTGGCTGCTTATACTGTACATATAATTAACGTCAAGATGTTTGGGGGAGGGGGAGTG
JMFF017D09- CTCTTGGCTGCTTATACTGTACATATAATTAACGTCAAGATGTTTGGGGGAGGGGGAGTG
                      ____________________________________________________________
consensus CTCTTGGCTGCTTATACTGTACATATAATTAACGTCAAGATGTTTGGGGGAGGGGGAGTG
 
. : . : . : . : . : . :
rJMSF046C24+ TCTTGGTCAATACCTCCAATCAGAAAAGTTGTGAATAACGGAATGAGAATCTCATACGTG
rJMFF017D09+ TCTTGGTCAATACCTCCAATCAGAAAAGTTGTGAATAACGGAATGAGAATCTCATACGTG
JMFF017D09- TCTTGGTCAATACCTCCAATCAGAAAAGTTGTGAATAACGGAATGAGAATCTCATACGTG
                      ____________________________________________________________
consensus TCTTGGTCAATACCTCCAATCAGAAAAGTTGTGAATAACGGAATGAGAATCTCATACGTG
 
. : . : . : . : . : . :
rJMSF046C24+ TACAGCAAGAAAAGTT
rJMFF017D09+ TACAGCAAAAAAAGTTTACTTTTAT
JMFF017D09- TACAGCAAAAAAAGTTTACTTTTATTGGAAAGTGATAATATTATGTTTAGAAAAAAAAAA
                      ____________________________________________________________
consensus TACAGCAAAAAAAGTTTACTTTTATTGGAAAGTGATAATATTATGTTTAGAAAAAAAAAA