Previous Contig 000872:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008K13Sequence566000872 (34)gb:AF059489_17650441e-62Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.610000872 (34)gb:AB099925_15261593e-07Malus x domestica MdEXPA4 mRNA for expansin, partial cds.
JMFF014J01Sequence477000872 (34)gb:AF492630_18049556e-48Capsicum annuum putative expansin (upa6) mRNA, complete cds.620000872 (34)gb:AF448467_18006680.001Prunus cerasus alpha-expansin mRNA, complete cds.
JMFF017B19Sequence553000872 (34)gb:AF059489_17650447e-61Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.516000872 (34)
JMFF019P05Sequence504000872 (34)gb:AF492630_18049559e-53Capsicum annuum putative expansin (upa6) mRNA, complete cds.767000872 (34)gb:AF297522_17840648e-20Prunus avium expansin 2 (Exp2) mRNA, complete cds.
JMFF020K17Sequence518000872 (34)gb:AF059489_17650441e-54Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.727000872 (34)gb:AF059489_17650441e-59Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.
JMFF021M18Sequence502000872 (34)gb:AF492630_18049558e-47Capsicum annuum putative expansin (upa6) mRNA, complete cds.674000872 (34)gb:AF059489_17650443e-86Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.
JMFF027C03Sequence492000872 (34)gb:AF492630_18049553e-52Capsicum annuum putative expansin (upa6) mRNA, complete cds.703000872 (34)gb:AF297522_17840642e-08Prunus avium expansin 2 (Exp2) mRNA, complete cds.
JMFF033O11Sequence461000872 (34)gb:AF492630_18049551e-43Capsicum annuum putative expansin (upa6) mRNA, complete cds.750000872 (34)gb:AF297522_17840643e-26Prunus avium expansin 2 (Exp2) mRNA, complete cds.
JMFF036B24Sequence567000872 (34)gb:AF059489_17650445e-64Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.714000872 (34)gb:AF059489_17650442e-57Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.
JMFF036P11Sequence545000872 (34)gb:AF059489_17650444e-62Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.730000872 (34)gb:AF059489_17650442e-57Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.
JMFF040D20Sequence467000872 (34)gb:AF492630_18049559e-45Capsicum annuum putative expansin (upa6) mRNA, complete cds.725000872 (34)gb:AF059489_17650443e-59Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.
JMFF044E16Sequence629000872 (34)gb:AF059489_17650447e-77Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.568013262 (16)gb:AY085449_15705183e-52Arabidopsis thaliana clone 152076 mRNA, complete sequence.
JMFF046G15Sequence639000872 (34)gb:AF059489_17650442e-75Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.585000872 (34)gb:AB047518_15206146e-40Prunus persica PpExp2 mRNA for expansin, complete cds.
JMFF049H09Sequence637000872 (34)gb:AF059489_17650441e-68Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.529000872 (34)gb:AF059489_17650442e-64Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.
JMFN033B22Sequence452000872 (34)gb:AF492630_18049551e-51Capsicum annuum putative expansin (upa6) mRNA, complete cds.
JMFN038K24Sequence550000872 (34)gb:AF059489_17650447e-69Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.
JMFS133D02Sequence599000872 (34)gb:AB047518_15206141e-19Prunus persica PpExp2 mRNA for expansin, complete cds.
JMFS141G10Sequence589000872 (34)gb:AF059489_17650441e-71Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.
JMSF041M05Sequence791000872 (34)gb:AF059489_1765044e-104Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.667011072 (12)gb:AY084661_15697491e-30Arabidopsis thaliana clone 11439 mRNA, complete sequence.
JMSF044L21Sequence767000872 (34)gb:AF059489_17650449e-97Lycopersicon esculentum expansin precursor (EXPA5) mRNA, complete cds.694000872 (34)gb:AB047518_15206141e-30Prunus persica PpExp2 mRNA for expansin, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF027C03- TATTAATACCAGAAAACATTACAGTTGCAGAAACATTA
rJMFF014J01- TATTAATACCAGAAAACATTACAGTTGCAGAAACATTA
rJMFF019P05- AACAGAGTTTTCATATTAATACCAGAAAACATTACAGTTGCAGAAACATTA
rJMFF033O11- ATTACAGTTGCAGAAACATTA
                      ____________________________________________________________
consensus AACAGAGTTTTCATATTAATACCAGAAAACATTACAGTTGCAGAAACATTA
 
. : . : . : . : . : . :
rJMFF017B19- AGCTTGAAGCTAAGGTTTCATTCATCTTACCTTACCTTCATATA
rJMFF008K13- ATTATCTGAAC-AGCTTGAAGCTAAGGTTTCATTCATCTTACCTTACCTTCATATA
rJMFF027C03- TTATATTATCTGAACAAGCTTGAAGCTAAGGTTTCATTCATCTTACCTTACCTTCATATA
rJMFF014J01- TTATATTATCTGAACAAGCTTGAAGCTAAGGTTTCATTCATCTTACCTTACCTTCATATA
rJMFF019P05- TTATATTATCTGAACAAGCTTGAAGCTAAGGTTTCATTCATCTTACCTTACCTTCATATA
rJMFF033O11- TTATATTATCTGAACAAGCTTGAAGCTAAGGTTTCATTCATCTTACCTTACCTTCATATA
rJMSF044L21- TTCATCTTACCTTACCTTCATATA
                      ____________________________________________________________
consensus TTATATTATCTGAACAAGCTTGAAGCTAAGGTTTCATTCATCTTACCTTACCTTCATATA
 
. : . : . : . : . : . :
rJMFF017B19- ACAACAATTAACTGTCTCCACACTCAGCATTATATTAGCTGTTTAACCTTAATGCTATAC
rJMFF008K13- ACAACAATTAACTGTCTCCACACTCAGCATTATATTAGCTGTTTAACCTTAATGCTATAC
rJMFF027C03- ACAACAATTAACTGTCTCCACACTCAGCATTATATTAGCTGTTTAACCTTAATGCTATAC
rJMFF014J01- ACAACAATTAACTGTCTCCACACTCAGCATTATATTAGCTGTTTAACCTTAATGCTATAC
rJMFF019P05- ACAACAATTAACTGTCTCCACACTCAGCATTATATTAGCTGTTTAACCTTAATGCTATAC
rJMFF033O11- ACAACAATTAACTGTCTCCACACTCAGCATTATATTAGCTGTTTAACCTTAATGCTATAC
JMFS133D02- AACTGTCTCCACACTCAGCATTATATTAGCTGTTTAACCTTAATGCTATAC
rJMSF044L21- ACAACAATTAACTGTCTCCACACTCAGCATTATATTAGCTGTTTAACCTTAATGCTATAC
                      ____________________________________________________________
consensus ACAACAATTAACTGTCTCCACACTCAGCATTATATTAGCTGTTTAACCTTAATGCTATAC
 
. : . : . : . : . : . :
rJMFF017B19- TAATTACAAACGACGAAGAAGAAGACGAGGAAAAATTAAT-GTTGTTCCACAGGGTAGGT
rJMFF008K13- TAATTACAAACGACGAAGAAGAAGACGAGGAAAAATTAAT-GTTGTTCCACAGGGTAGGT
rJMFF027C03- TAATTACAAACGACGAAGAAGAAGACGAGGAAAAATTAAT-GTTGTTCCACAGGGTAGGT
rJMFF014J01- TAATTACAAACGACGAAGAAGAAGACGAGGAAAAATTAAT-GTTGTTCCACAGGGTAGGT
rJMFF019P05- TAATTACAAACGACGAAGAAGAAGACGAGGAAAAATTAAT-GTTGTTCCACAGGGTAGGT
rJMFF033O11- TAATTACAAACGACGAAGAAGAAGACGAGGAAAAATTAAT-GTTGTTCCACAGGGTAGGT
JMFS133D02- TAATTACAAACGACGAAGAAGAAGACGAGGAAAAATTAAT-GTTGTTCCACAGGGTAGGT
rJMSF044L21- TAATTACAAACGACGAAGAAGAAGACGAGGAAAAATTAAT-GTTGTTCCACAGGGTAGGT
rJMFF036P11- CGAGGAAAAATTAATGGTTGTTCCACAGGGTAGGT
rJMFF036B24- CAGGGTAGGT
rJMFF040D20- AT-GTTGTTCC-CAGGGTAGGT
rJMFF020K17- CAGGGTAGGT
                      ____________________________________________________________
consensus TAATTACAAACGACGAAGAAGAAGACGAGGAAAAATTAAT-GTTGTTCCACAGGGTAGGT
 
. : . : . : . : . : . :
rJMFF017B19- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMFF008K13- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMFF027C03- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMFF014J01- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMFF019P05- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMFF033O11- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
JMFS133D02- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMSF044L21- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMFF036P11- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMFF036B24- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMFF040D20- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMFF046G15- GCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
rJMFF020K17- ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
                      ____________________________________________________________
consensus ATGCAGATACATTTTGTCTGCATAATAATATATAATCACATAAATAATGCAGTACTAAAC
 
. : . : . : . : . : . :
rJMFF017B19- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMFF008K13- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMFF027C03- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMFF014J01- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMFF019P05- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMFF033O11- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
JMFS133D02- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMSF044L21- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMFF036P11- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMFF036B24- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMFF040D20- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMFF046G15- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
rJMFF020K17- TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
                      ____________________________________________________________
consensus TAGTCATGGGATAGCACAAGCTTGATATAACTAACTACCTCTCTGCTTCTTGTGGATTTA
 
. : . : . : . : . : . :
rJMFF017B19- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMFF008K13- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMFF027C03- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMFF014J01- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMFF019P05- ATGGCCATTTTAATGGCGAAAAGGGCTTCCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMFF033O11- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
JMFS133D02- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMSF044L21- ATGGCCATTTTAAAGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMFF036P11- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMFF036B24- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMFF040D20- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMFF046G15- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
rJMFF020K17- ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
                      ____________________________________________________________
consensus ATGGCCATTTTAATGGCGAAAAGGGCTTTCGAAAACCAATCCCTTTTAGAAAAAAGTGAG
 
. : . : . : . : . : . :
rJMFF017B19- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF008K13- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF027C03- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF014J01- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF019P05- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF033O11- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
JMFS133D02- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMSF044L21- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF036P11- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF036B24- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF040D20- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF046G15- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF020K17- AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF049H09- GATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
rJMFF021M18- TCCCCATGACTTTACATTTC
                      ____________________________________________________________
consensus AGAGGGCGGCCGGAAACTTGATCAATATAATATTTTCCCATCCCCATGACTTTACATTTC
 
. : . : . : . : . : . :
rJMFF017B19- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF008K13- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF027C03- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF014J01- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF019P05- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF033O11- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
JMFS133D02- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMSF044L21- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF036P11- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF036B24- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF040D20- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF046G15- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF020K17- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF049H09- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
rJMFF021M18- AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
                      ____________________________________________________________
consensus AAACTTGTAAAAATGGTGTAGGCTTTAGTTATGTATAGGTTTGGAGATTATATATATGAC
 
. : . : . : . : . : . :
rJMFF017B19- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAAC
rJMFF008K13- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
rJMFF027C03- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCCGGGAGT
rJMFF014J01- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
rJMFF019P05- GGAAAACAAAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCCGGGAGT
rJMFF033O11- GGAAAACAAAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCCGGGAGT
JMFS133D02- GAAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
rJMSF044L21- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
rJMFF036P11- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
rJMFF036B24- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
rJMFF040D20- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
rJMFF046G15- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
rJMFF020K17- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
rJMFF049H09- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
rJMFF021M18- GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
JMSF041M05+ TCCTAGCGGAACTGGGCGCC-GGAGT
                      ____________________________________________________________
consensus GGAAAAC-AAAAAAATGGGGGTGTTTGAATTCATTCCTAGCGGAACTGGGCGCC-GGAGT
 
. : . : . : . : . : . :
rJMFF008K13- AGGTCTGGCCGAAGGATCAGCCCGCC-GGAGCGGCGTTGTANGATACGAGGCTGCGGCCG
rJMFF027C03- AGGTCTGGCCGAAGGACCAGCCCGCCGGGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
rJMFF014J01- ANGTCTGGCCGAANGACCAGCCCGCC-GGAGCGGCGTTGT
rJMFF019P05- AGGTCTGGCCGAAGGACCAGCCCGCCGGGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
rJMFF033O11- AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
JMFS133D02- AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
rJMSF044L21- AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
rJMFF036P11- AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
rJMFF036B24- AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
rJMFF040D20- AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
rJMFF046G15- AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
rJMFF020K17- AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
rJMFF049H09- AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
rJMFF021M18- AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
JMSF041M05+ AGGTCTGGCCGAAGGACCAGCCNGCN-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
JMSF044L21+ GAAGGACCAGCCCGCC-GGAGCGGCGTTNTAGGATACGAGGCTGCGGCCG
                      ____________________________________________________________
consensus AGGTCTGGCCGAAGGACCAGCCCGCC-GGAGCGGCGTTGTAGGATACGAGGCTGCGGCCG
 
. : . : . : . : . : . :
rJMFF008K13- TCGCCGGTGACTACCCGGA
rJMFF027C03- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGANGNTGGCGTTGCTCTGCCAG
rJMFF019P05- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
rJMFF033O11- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGANGTTGGCGTTGCTCTGCCAG
JMFS133D02- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
rJMSF044L21- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
rJMFF036P11- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
rJMFF036B24- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
rJMFF040D20- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
rJMFF046G15- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
rJMFF020K17- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
rJMFF049H09- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
rJMFF021M18- TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
JMSF041M05+ TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
JMSF044L21+ TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTNCCAG
                      ____________________________________________________________
consensus TCGCCGGTGACTACCCGGAAAGAGAGGCTTTGGCCGTTGAGGTTGGCGTTGCTCTGCCAG
 
. : . : . : . : . : . :
rJMFF027C03- T
rJMFF019P05- TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTAC
rJMFF033O11- TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
JMFS133D02- TTTTGGCCCCAG
rJMSF044L21- TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
rJMFF036P11- TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
rJMFF036B24- TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
rJMFF040D20- TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
rJMFF046G15- TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
rJMFF020K17- TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
rJMFF049H09- TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
rJMFF021M18- TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
JMSF041M05+ TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
JMFS141G10+ GATGTACACG
JMFF044E16+ GGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
JMSF044L21+ TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
JMFF049H09+ GGACATCATTTGCCACCCGGTTCTGATCCCTTTGATGTACACG
JMFF046G15+ GGACATCATTTGCCACCCGGTTCTGATCCCTNTGATGTACACG
                      ____________________________________________________________
consensus TTTTGGCCCCAGTTTCTGGACATCATTTGCCACCCGGTTCTTGATCCTTTGATGTACACG
 
. : . : . : . : . : . :
rJMFF033O11- GCGTGTACGTC
rJMSF044L21- GCGTGTACGTCGCC
rJMFF036P11- GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
rJMFF036B24- GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
rJMFF040D20- GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
rJMFF046G15- GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
rJMFF020K17- GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
rJMFF049H09- GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
rJMFF021M18- GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
JMSF041M05+ GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
JMFS141G10+ GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
JMFN038K24+ TGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
JMFF044E16+ GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
JMFF036P11+ CAGGTTGAAGAAAGCATGG
JMSF044L21+ GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
JMFF049H09+ GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTGNAAGAAAGCATGG
JMFF008K13+ GTTACTAGAACCAGGTTGAAGAAAGCATGG
JMFF036B24+ TGGTTACTAGAACCAGGTTGAAGAAAGCATGN
JMFF046G15+ GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
JMFF017B19+ TGAAGAAAGCATGG
                      ____________________________________________________________
consensus GCGTGTACGTCGCCGGAGCCTCCCACGTTGGTTACTAGAACCAGGTTGAAGAAAGCATGG
 
. : . : . : . : . : . :
rJMFF036P11- CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
rJMFF036B24- CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
rJMFF040D20- CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
rJMFF046G15- CCATTAA
rJMFF020K17- CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
rJMFF049H09- CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
rJMFF021M18- CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
JMSF041M05+ CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
JMFS141G10+ CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
JMFN038K24+ CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
JMFF044E16+ CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
JMFF036P11+ CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
JMSF044L21+ CCATTAATGGTGAACCTGATTCCTCCACTTCTCNTGCAAGGCACCCGTCTGTAAGCAACG
JMFF049H09+ CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
JMFF027C03+ TGCAAGGCACCCGTCTGTAAGCAACG
JMFF014J01+ AAGCAACG
JMFN033B22+ TGCAAGGCACCCGTCTGTAAGCAACG
JMFF008K13+ CCATTAATGGTGAACCTGATTCCTCCACTTCCCCTGCAAGGCACCCGTCTGTAAGCAACG
JMFF036B24+ CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
JMFF046G15+ CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
JMFF020K17+ ATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
JMFF019P05+ CCTGCAAGGCACCCGTCTGTAAGCAACG
JMFF021M18+ CCTGCAAGGCACCCGTCTGTAAGCAACG
JMFF017B19+ CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
                      ____________________________________________________________
consensus CCATTAATGGTGAACCTGATTCCTCCACTTCTCCTGCAAGGCACCCGTCTGTAAGCAACG
 
. : . : . : . : . : . :
rJMFF036P11- GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAA
rJMFF036B24- GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAA
rJMFF040D20- GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGA
rJMFF020K17- GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGA
rJMFF049H09- GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
rJMFF021M18- GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMSF041M05+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFS141G10+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFN038K24+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF044E16+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF036P11+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMSF044L21+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF049H09+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF027C03+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF014J01+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFN033B22+ GGAACAACTCCGGCTCGGTGCTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF008K13+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF036B24+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF046G15+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF020K17+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF019P05+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF021M18+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF040D20+ CCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF033O11+ CTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
JMFF017B19+ GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
                      ____________________________________________________________
consensus GGAACAACTCCGGCTCTGTACTGGGCAATTCTCAAGAAAACAGGCTGAGAGAGATCAAAA
 
. : . : . : . : . : . :
rJMFF049H09- TGGGGGTTGGG
rJMFF021M18- TGGGGGTTGGGAGGCTCGCACCAGCCGCCGG--GGGCAGAAATTGGTGGCGGTGACGGTG
JMSF041M05+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFS141G10+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFN038K24+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF044E16+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF036P11+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMSF044L21+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF049H09+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGG--GGGCAGAAATTGGTGGCGGTGACGGTG
JMFF027C03+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF014J01+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFN033B22+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF008K13+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF036B24+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF046G15+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF020K17+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF019P05+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF021M18+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGG--GGGCAGAAATTGGTGGCGGTGACGGTG
JMFF040D20+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF033O11+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
JMFF017B19+ TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
                      ____________________________________________________________
consensus TGGGGGTTGGGAGGCTCGCACCAGCCGCCGGGCGGGCAGAAATTGGTGGCGGTGACGGTG
 
. : . : . : . : . : . :
rJMFF021M18- ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTANCTGGAAACAGGCGCCGCAG
JMSF041M05+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFS141G10+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFN038K24+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF044E16+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF036P11+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMSF044L21+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF049H09+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF027C03+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF014J01+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFN033B22+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF008K13+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF036B24+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF046G15+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF020K17+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF019P05+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF021M18+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF040D20+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF033O11+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
JMFF017B19+ ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
                      ____________________________________________________________
consensus ATTACGCCGCGGAGGCAGGAGCGGTCGTTCACACACCTTAGCTGGAAACAGGCGCCGCAG
 
. : . : . : . : . : . :
rJMFF021M18- CTGAGGCCATTGTTGAANANAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCA
JMSF041M05+ CTGAGGCCATTGTTGAAGAGAGCTGTGNTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFS141G10+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFN038K24+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF044E16+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF036P11+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMSF044L21+ CTGAGGCCATTGTTGAAGAGAGCTGTGNTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF049H09+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF027C03+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF014J01+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFN033B22+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF008K13+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF036B24+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF046G15+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF020K17+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF019P05+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF021M18+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF040D20+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF033O11+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
JMFF017B19+ CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
                      ____________________________________________________________
consensus CTGAGGCCATTGTTGAAGAGAGCTGTGCTGAGTGCGGCAGTGTTGGTGCCATAGCCTGAG
 
. : . : . : . : . : . :
JMSF041M05+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFS141G10+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFN038K24+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF044E16+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF036P11+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMSF044L21+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF049H09+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF027C03+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF014J01+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFN033B22+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF008K13+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF036B24+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF046G15+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF020K17+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF019P05+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF021M18+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF040D20+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF033O11+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
JMFF017B19+ CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
                      ____________________________________________________________
consensus CTGTACAGGTTCCCATAGCCGCAAGCTCCGCCCATTGTTCCAGAAGCATCACCGCCGCCG
 
. : . : . : . : . : . :
JMSF041M05+ TAGAAGGTGGCGCGAGCGNTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFS141G10+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFN038K24+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF044E16+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF036P11+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMSF044L21+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF049H09+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF027C03+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF014J01+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFN033B22+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAGCGTAGCA
JMFF008K13+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF036B24+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF046G15+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF020K17+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF019P05+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF021M18+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF040D20+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF033O11+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
JMFF017B19+ TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
                      ____________________________________________________________
consensus TAGAAGGTGGCGCGAGCGCTGCTCCAGCCCCAGTAGCCATGCACCGGAGACAACGTAGCA
 
. : . : . : . : . : . :
JMSF041M05+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFS141G10+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFN038K24+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF044E16+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF036P11+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMSF044L21+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF049H09+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF027C03+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF014J01+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATCATTGTTTCTGCTTTTCCTTTCCAG
JMFN033B22+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF008K13+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF036B24+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF046G15+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF020K17+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF019P05+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF021M18+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF040D20+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF033O11+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
JMFF017B19+ AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
                      ____________________________________________________________
consensus AGAACTCCGACCAGAAGAAGCTCAAGAACCGCCATTATTGTTTCTGCTTTTCCTTTCCAG
 
. : . : . : . : . : . :
JMSF041M05+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAAT
JMFS141G10+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAG
JMFN038K24+ AATGGT
JMFF044E16+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CT
JMFF036P11+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CT
JMSF044L21+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATATCTGGGGAGATG
JMFF049H09+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGGAGATGT
JMFF027C03+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CT
JMFF014J01+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGG
JMFN033B22+ AATGGT
JMFF008K13+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGGAGA
JMFF036B24+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGG
JMFF046G15+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGGAGATGT
JMFF020K17+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGGAGATGT
JMFF019P05+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGGAGATGT
JMFF021M18+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGGAGATGT
JMFF040D20+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGGAGATGT
JMFF033O11+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGGAGATGT
JMFF017B19+ AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGGAGATGTGAA
                      ____________________________________________________________
consensus AATGGTTGAATTGAATTGAATTAAAGTTGCTTGGTAGAGGAATA-CTGGGGAGATGTGAA