Previous Contig 000860:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002O14Sequence522000860 (17)gb:AY078958_15681131e-60Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A740009468 (15)pir|C96814|C968144e-90hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMFF009L12Sequence625000860 (17)gb:AY078958_15681132e-78Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A741009468 (15)pir|C96814|C968141e-68hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMFF016N03Sequence592000860 (17)gb:AY078958_15681131e-73Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A734009468 (15)pir|C96814|C968141e-77hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMFF024G02Sequence523000860 (17)gb:AY078958_15681131e-60Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A761009468 (15)pir|C96814|C968147e-77hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMFF028C18Sequence528000860 (17)gb:AY078958_15681132e-60Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A746009468 (15)pir|C96814|C968143e-74hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMFF031P11Sequence563000860 (17)gb:AY078958_15681134e-79Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A772021371pir|C96814|C968144e-73hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMFF038E13Sequence165000860 (17)gb:AY078958_15681139e-21Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A531021543gb:AF051236_17642254e-34Picea mariana hypothetical protein (Sb50) mRNA, partial cds.
JMFF040E18Sequence521000860 (17)gb:AY078958_15681131e-60Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A759009468 (15)pir|C96814|C968145e-76hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMFS104C03Sequence617000860 (17)gb:AY078958_15681133e-81Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A
JMFS144A02Sequence612000860 (17)gb:AY078958_15681133e-81Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A
JMFS161D02Sequence604000860 (17)gb:AY078958_15681132e-80Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A
JMSF002N21Sequence297000860 (17)pir|C96814|C968143e-18hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895729009468 (15)pir|C96814|C968145e-76hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMSF023B09Sequence658000860 (17)gb:AY078958_15681131e-86Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A551009468 (15)pir|C96814|C968148e-38hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMSF025D09Sequence670000860 (17)gb:AY078958_1568113e-102Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A770009468 (15)pir|C96814|C968146e-79hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMSF028H03Sequence662000860 (17)gb:AY078958_15681132e-85Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A732009468 (15)pir|C96814|C968144e-73hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMSF040F05Sequence667000860 (17)gb:AY078958_15681131e-87Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A905009468 (15)pir|C96814|C96814e-109hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMSF049L09Sequence684000860 (17)gb:AY078958_15681138e-91Arabidopsis thaliana AT3g14790/T21E2_4 mRNA, complete cds.>gb:AY142060_1582897 A769009468 (15)pir|C96814|C96814e-102hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025D09+ CCATACACATTATTTCCTCG
                      ____________________________________________________________
consensus CCATACACATTATTTCCTCG
 
. : . : . : . : . : . :
JMSF025D09+ AGTGGTTATCACAGGCAACCCATATGACCTACCATAAGCCATAACAAGCATTTCAGCCCC
JMSF040F05+ CC
JMSF023B09+ C
JMSF049L09+ AAGCCATAACAAGCATTTCAGCCCC
JMSF028H03+ CC
                      ____________________________________________________________
consensus AGTGGTTATCACAGGCAACCCATATGACCTACCATAAGCCATAACAAGCATTTCAGCCCC
 
. : . : . : . : . : . :
JMSF025D09+ AGCTTTTGTGGCTGAATAGGGGTTTGTGGGAAGGAGTTGTGAGGCCTCATGATTTCCCAC
JMFS144A02+ GTGGGAAGGAGTTGTGAGGCCTCATGATTTCCCAC
JMFS161D02+ GGAAGGAGTTGTGAGGCCTCATGATTTCCCAC
JMFF031P11+ GAAGGAGTTGTGAGGCTTCATGATTTCCCAC
JMFS104C03+ GTGGGAAGGAGTTGTGAGGCCTCATGATTTCCCAC
JMSF040F05+ AGCTTTTGTGGCTGAATAGGGGTTTGTGGGAAGGAGTTGTGAGGCCTCATGATTTCCCAC
JMSF023B09+ AGCTTTTGTGGCTGAATAGGGGTTTGTGGGAAGGAGTTGTGAGGCCTCATGATTTCCCAC
JMFF009L12+ GAGTTGTGAGGCNTCATGATTTCCCAC
JMSF049L09+ AGCTTTTGTGGCTGAATAGGGGTTTGTGGGAAGGAGTTGTGAGGCCTCATGATTTCCCAC
JMSF028H03+ AGCTTTTGTGGCTGAATAGGGGTTTGTGGGAAGGAGTTGTGAGGCCTCATGATTTCCCAC
                      ____________________________________________________________
consensus AGCTTTTGTGGCTGAATAGGGGTTTGTGGGAAGGAGTTGTGAGGCCTCATGATTTCCCAC
 
. : . : . : . : . : . :
JMSF025D09+ AACAGCATCCTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
JMFS144A02+ AACAGCATCCTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
JMFS161D02+ AACAGCATCCTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
JMFF031P11+ AACAGCATCCTCGTCAGTCTCCCCGTAGACCTCATCTGTGCTGACATGGATAAATCTTCT
JMFS104C03+ AACAGCATCCTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
JMSF040F05+ AACAGCATCCTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
JMSF023B09+ AACAGCATCCTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
JMFF009L12+ AACAGCATCNTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
JMSF049L09+ AACAGCATCCTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
JMSF028H03+ AACAGCATCCTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
JMFF016N03+ CCTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
                      ____________________________________________________________
consensus AACAGCATCCTCATCAGTCTCCCCATAGACCTCATCTGTGCTGACATGGATGAACCTTCT
 
. : . : . : . : . : . :
JMSF025D09+ GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMFS144A02+ GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMFS161D02+ GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMFF031P11+ GATCTGACCAGTAACTTTGCAGGCCTCCAATAGTACATGGGTGCCATAAATGTTGTTCTT
JMFS104C03+ GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMSF040F05+ GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMSF023B09+ GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMFF028C18+ GTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMFF024G02+ ACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMFF040E18+ CTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMFF009L12+ GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMFF002O14+ CTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMSF049L09+ GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMSF028H03+ GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
JMFF016N03+ GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
                      ____________________________________________________________
consensus GATCTGGCCTGTAACCTTGCAAGCCTCCAATAGTACATGAGTACCGTAGATGTTGTTCTT
 
. : . : . : . : . : . :
JMSF025D09+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMFS144A02+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMFS161D02+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMFF031P11+ GGTAAACTCAAAGCTGTTACCGAACGAGTTGTCAACGTGGGTCTGAGCAGCAAAATGCAT
JMFS104C03+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMSF040F05+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMSF023B09+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMFF028C18+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMFF024G02+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMFF040E18+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMFF009L12+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMFF002O14+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMSF049L09+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMSF028H03+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
JMFF016N03+ GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
                      ____________________________________________________________
consensus GGTGAACTCAAAGCTGTTACCAAAGGAGTTGTCCACATGAGTCTGAGCAGCAAAGTGCAT
 
. : . : . : . : . : . :
JMSF025D09+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMFS144A02+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMFS161D02+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMFF031P11+ TATTGTGTCTATGGACTCAGTGATGAGTAGGTAATTAACAAGATCAGCACTTGCAATGTC
JMFS104C03+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMSF040F05+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMSF023B09+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMFF028C18+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMFF024G02+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMFF040E18+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMFF009L12+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMFF002O14+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMSF049L09+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMSF028H03+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
JMFF016N03+ TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
                      ____________________________________________________________
consensus TATTGTGTCTATATTCTCAGTGATCAGGAGGTAGTTAACCAGATCAGCACTGCCAATGTC
 
. : . : . : . : . : . :
JMSF025D09+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMFS144A02+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMFS161D02+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMFF031P11+ CCCCTTAACAAACTTGAAGTTAGGGGATGAGCGAGAGGGAAGAAGGTTCTTAAGATTTGA
JMFF038E13+ TAACAAACTTGAAGTTAGGGGATGAGCGAGAGGGAAGAAGGTTCTTAAGATTTGA
JMFS104C03+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMSF040F05+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMSF023B09+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMFF028C18+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGCTCTTGAGATTCGA
JMFF024G02+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMFF040E18+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMSF002N21+ CGA
JMFF009L12+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMFF002O14+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMSF049L09+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMSF028H03+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
JMFF016N03+ CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
                      ____________________________________________________________
consensus CCCCTTAACAAACTTGAAGTTGGGGGAAGAGCGAGATGGAGTGAGGTTCTTGAGATTCGA
 
. : . : . : . : . : . :
JMSF025D09+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMFS144A02+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMFS161D02+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMFF031P11+ ACAGTAGTCTAGTTTATCAACAATAACAATCTTGTAATTAGGATAGCTCCGGACAAGTCG
JMFF038E13+ ACAGTAGTNTAGTTTATCAACAATAACAATCTTGTAATTAGGATAGCTCCGGACAAGTCG
JMFS104C03+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMSF040F05+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMSF023B09+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMFF028C18+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMFF024G02+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMFF040E18+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMSF002N21+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMFF009L12+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMFF002O14+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMSF049L09+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
JMSF028H03+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATTGCTCCGGACAAGTCG
JMFF016N03+ ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
                      ____________________________________________________________
consensus ACAGTAGTCAAGCTTATCGAGGACAACAATCTTGTAATCCGGATAGCTCCGGACAAGTCG
 
. : . : . : . : . : . :
JMSF025D09+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMFS144A02+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMFS161D02+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMFF031P11+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCCCCAGTAATGAGGATATTCTTTGGGGT
JMFF038E13+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCCCCAGTAATGAGGATAT
JMFS104C03+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMSF040F05+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMSF023B09+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMFF028C18+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMFF024G02+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMFF040E18+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMSF002N21+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMFF009L12+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMFF002O14+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMSF049L09+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMSF028H03+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
JMFF016N03+ ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
                      ____________________________________________________________
consensus ATTTGCAACATGAGATGCAATAAATCCGGCAGCACCGGTAATCAGGATATTCTTCGGGGT
 
. : . : . : . : . : . :
JMSF025D09+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMFS144A02+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMFS161D02+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMFF031P11+ GTAAGTTG
JMFS104C03+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMSF040F05+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMSF023B09+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMFF028C18+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMFF024G02+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMFF040E18+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMSF002N21+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMFF009L12+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMFF002O14+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMSF049L09+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMSF028H03+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
JMFF016N03+ GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
                      ____________________________________________________________
consensus GTACGTTGCCATCTTAACAGAGATTTCCTATTGTGCAATCCGGATCAGAATCACTCCGTA
 
. : . : . : . : . : . :
JMSF025D09+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTC
JMFS144A02+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMFS161D02+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMFS104C03+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMSF040F05+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMSF023B09+ GTAGATAGATAAGATAAGAGGGGG--AAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMFF028C18+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMFF024G02+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMFF040E18+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMSF002N21+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMFF009L12+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMFF002O14+ GTAGATAGATAAGATAAGAGGGGG-AAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMSF049L09+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMSF028H03+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
JMFF016N03+ GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
                      ____________________________________________________________
consensus GTAGATAGATAAGATAAGAGGGGGAAAAAAAAGTGAAAAATTAAATTCCGAGTAGGAGAA
 
. : . : . : . : . : . :
JMFS144A02+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGA
JMFS161D02+ AAATTCAGACAAAGGTGTTATAGAGGAAGACT
JMFS104C03+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGAC
JMSF040F05+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGAT
JMSF023B09+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGATG
JMFF028C18+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGATGC
JMFF024G02+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGAT
JMFF040E18+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGAT
JMSF002N21+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGT
JMFF009L12+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGATGC
JMFF002O14+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGATGC
JMSF049L09+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGATGC
JMSF028H03+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGATGC
JMFF016N03+ AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGATGCCA
                      ____________________________________________________________
consensus AAATTCAGACAAAGGTGTTATAGAGGAAGACTAGGGAGAGACGACGGGGGCGTGATGCCA