Previous Contig 000859:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016M21Sequence531000859 (2)442009225 (2)gb:ATAC021640_15437452e-21Arabidopsis thaliana chromosome III BAC F16B3 genomic sequence, complete sequenc
JMFF021L05Sequence517000859 (2)537009225 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF021L05+ CTCCTCCTCATCCCCTAGAGACACCTCAGGCTCACCATCCTCCTTA
JMFF016M21+ TCCTCCTCCTCCTCCTCCCCTAGAGACACCTCAGGCTCACCATCCTCCTTA
                      ____________________________________________________________
consensus TCCTCCTCCTCCTCCTCCCCTAGAGACACCTCAGGCTCACCATCCTCCTTA
 
. : . : . : . : . : . :
JMFF021L05+ ACAACAAACGGAACCTCACCATTTTCGACGGCGAAATCATTCCCAGCAGCGAAGCCATCA
JMFF016M21+ ACAACAAACGGAACCTCACCATTTTCGACGGCGAAATCATTCCCAGCAGCGAAGCCATCA
                      ____________________________________________________________
consensus ACAACAAACGGAACCTCACCATTTTCGACGGCGAAATCATTCCCAGCAGCGAAGCCATCA
 
. : . : . : . : . : . :
JMFF021L05+ TCGACTTCACCGAAAACAGAGGAAGACCCATCCTGGGATTTTTCCTCATCGAAAGCGCTG
JMFF016M21+ TCGACTTCACCGAAAACAGAGGAAGACCCATCCTGGGATTTTTCCTCATCGAAAGCGCTG
                      ____________________________________________________________
consensus TCGACTTCACCGAAAACAGAGGAAGACCCATCCTGGGATTTTTCCTCATCGAAAGCGCTG
 
. : . : . : . : . : . :
JMFF021L05+ GCCCAATGACCAGACGCGGAGGCGTCTGCGTTGGAAAACTCAGATTCTTCGGAATCGAGT
JMFF016M21+ GCCCAATGACCAGACGCGGAGGCGTCTGCGTTGGAAAACTCAGATTCTTCGGAATCGAGT
                      ____________________________________________________________
consensus GCCCAATGACCAGACGCGGAGGCGTCTGCGTTGGAAAACTCAGATTCTTCGGAATCGAGT
 
. : . : . : . : . : . :
JMFF021L05+ GACGGATTTGACGAGAAAAACCTAAACGAGTATTGGCAAACGCAGTTCCTAGAAGCAGTG
JMFF016M21+ GACGGATTTGACGAGAAAAACCTAAACGAGTATTGGCAAACGCAGTTCCTAGAAGCAGTG
                      ____________________________________________________________
consensus GACGGATTTGACGAGAAAAACCTAAACGAGTATTGGCAAACGCAGTTCCTAGAAGCAGTG
 
. : . : . : . : . : . :
JMFF021L05+ AAATGTGGAGTTGGGTTCAATGGAGATTCAATTGAGTAGCATACCTGAGAAGTGCTTTGG
JMFF016M21+ AAATGTGGAGTTGGGTTCAATGGAGATTCAATTGAGTAGCATACCTGAGAAGTGCTTTGG
                      ____________________________________________________________
consensus AAATGTGGAGTTGGGTTCAATGGAGATTCAATTGAGTAGCATACCTGAGAAGTGCTTTGG
 
. : . : . : . : . : . :
JMFF021L05+ AGTATGGAGTGCTTTAATCTTGCTTCAAGCCTTCTGAGAAGAGCTTTTCTACCTACAGTA
JMFF016M21+ AGTATGGAGTGCTTTAATCTTGCTTCAAGCCTTCTGAGAAGAGCTTTTCTACCTACAGTA
                      ____________________________________________________________
consensus AGTATGGAGTGCTTTAATCTTGCTTCAAGCCTTCTGAGAAGAGCTTTTCTACCTACAGTA
 
. : . : . : . : . : . :
JMFF021L05+ ATCGTCGATCTCAACATCTCTCCTCTCCTCTCCTCTCCTCTGTAGAGTGTAGGGTTGAAT
JMFF016M21+ ATCGTCGATCTCAACATCTCTCCTCTCCTCTCCTCTCCTCTGTAGAGTGTAGGGTTGAAT
                      ____________________________________________________________
consensus ATCGTCGATCTCAACATCTCTCCTCTCCTCTCCTCTCCTCTGTAGAGTGTAGGGTTGAAT
 
. : . : . : . : . : . :
JMFF021L05+ GTATAGTTCAGAGAAGAGAAACCCTTCGGGGGAAAAGCCTCGGCAGTTGGC
JMFF016M21+ GTATAGTTCAGAGAAGAGAAACCCTTCGGGGGAAAAGCCTCGGCAGTTGGCAGCGCCGGC
                      ____________________________________________________________
consensus GTATAGTTCAGAGAAGAGAAACCCTTCGGGGGAAAAGCCTCGGCAGTTGGCAGCGCCGGC