Previous Contig 000853:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002D03Sequence574000853 (3)gb:AB026644_15171557e-43Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MFJ20.>gb:AK117357_181745008215 (3)gb:AE005172_8915988e-60Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC000348_153007
JMFF016K13Sequence645000853 (3)gb:AB026644_15171554e-45Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MFJ20.>gb:AK117357_181777008215 (3)gb:AE005172_8915982e-63Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC000348_153007
JMSF007D24Sequence411000853 (3)gb:AB026644_15171552e-19Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MFJ20.>gb:AK117357_181756008215 (3)gb:AE005172_8915987e-64Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC000348_153007

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF002D03+ TTCCAGTCAATTTGTTATC
JMFF016K13+ CAAACTAGCAATCTGAGATGGAATGTTTCCAGTCAATTTGTTATC
                      ____________________________________________________________
consensus CAAACTAGCAATCTGAGATGGAATGTTTCCAGTCAATTTGTTATC
 
. : . : . : . : . : . :
JMFF002D03+ GTTAAGTATCAACTTATTCAAATACGTGCAATTGCCGAGATCCGGGGGGATTGGCCCGGT
JMFF016K13+ GTTAAGTATCAACTTATTCAAATACGTGCAATTGCCGAGATCCGGGGGGATTGGCCCGGT
                      ____________________________________________________________
consensus GTTAAGTATCAACTTATTCAAATACGTGCAATTGCCGAGATCCGGGGGGATTGGCCCGGT
 
. : . : . : . : . : . :
JMFF002D03+ CAAATCGTTGCTGGACAAGTCTAGGGTTACTAAATAAGGCAACCAACGACAAATTTGAGA
JMFF016K13+ CAAATCGTTGCTGGACAAGTCTAGGGTTACTAAATAAGGCAACCAACGACAAATTTGAGA
                      ____________________________________________________________
consensus CAAATCGTTGCTGGACAAGTCTAGGGTTACTAAATAAGGCAACCAACGACAAATTTGAGA
 
. : . : . : . : . : . :
JMFF002D03+ AGGTATGGTACCGGAGAGTCCATTACCGGAGAGATCGAGGTTCTGCAAGCTGTGACAGTC
JMSF007D24+ CCGGAGAGATCGAGGTTNTGCAAGCTGTGACAGTC
JMFF016K13+ AGGTATGGTACCGGAGAGTCCATTACCGGAGAGATCGAGGTTCTGCAAGCTGTGACAGTC
                      ____________________________________________________________
consensus AGGTATGGTACCGGAGAGTCCATTACCGGAGAGATCGAGGTTCTGCAAGCTGTGACAGTC
 
. : . : . : . : . : . :
JMFF002D03+ CTGCAAGGCGCCGGGAACCTCGCCGCCGAGGTTCAACTCCCGGAGCTCCAACCCGATCAC
JMSF007D24+ CTGCAAGGCGCCGGGAACCTCGCCGCCGAGGTTCAACTCCCGGAGCTCCAACCCGATCAC
JMFF016K13+ CTGCAAGGCGCCGGGAACCTCGCCGCCGAGGTTCAACTCCCGGAGCTCCAACCCGATCAC
                      ____________________________________________________________
consensus CTGCAAGGCGCCGGGAACCTCGCCGCCGAGGTTCAACTCCCGGAGCTCCAACCCGATCAC
 
. : . : . : . : . : . :
JMFF002D03+ GCGATTCTCGTTGTCGTTCCAGCACGCCACGCCGACGAACTTGCAGATGAACCCGGCCGT
JMSF007D24+ GCGATTCTCGTTGTCGTTCCAGCACGCCACGCCGACGAACTTGCAGATGAACCCGGCCGT
JMFF016K13+ GCGATTCTCGTTGTCGTTCCAGCACGCCACGCCGACGAACTTGCAGATGAACCCGGCCGT
                      ____________________________________________________________
consensus GCGATTCTCGTTGTCGTTCCAGCACGCCACGCCGACGAACTTGCAGATGAACCCGGCCGT
 
. : . : . : . : . : . :
JMFF002D03+ CGTGTTGTCAAAGTTCCACAGCCCCAGGTTGCCGTCCGGATCCCTAAACGACCCCTTCAC
JMSF007D24+ CGTGTTGTCAAAGTTCCACAGCCCCAGGTTGCCGTCCGGATCCCTAAACGACCCCTTCAC
JMFF016K13+ CGTGTTGTCAAAGTTCCACAGCCCCAGGTTGCCGTCCGGATCCCTAAACGACCCCTTCAC
                      ____________________________________________________________
consensus CGTGTTGTCAAAGTTCCACAGCCCCAGGTTGCCGTCCGGATCCCTAAACGACCCCTTCAC
 
. : . : . : . : . : . :
JMFF002D03+ ACCTTGCAAACACTTGACGTCATCTTCAGCCACCCCAACTCCGAACAGCACCAGAAGAAT
JMSF007D24+ ACCTTGCAAACACTTGACGTCATCTTCAGCCACCCCAACTCCGAACAGCACCAGAAGAAT
JMFF016K13+ ACCTTGCAAACACTTGACGTCATCTTCAGCCACCCCAACTCCGAACAGCACCAGAAGAAT
                      ____________________________________________________________
consensus ACCTTGCAAACACTTGACGTCATCTTCAGCCACCCCAACTCCGAACAGCACCAGAAGAAT
 
. : . : . : . : . : . :
JMFF002D03+ CGAAAGCTTCAAAAAACGGGAAAACCCAAACCCAACCATCCTAAAATCCGCTCAGTTCTA
JMSF007D24+ CGAAAGCTTCAAAAAACGGGAAAACCCAAACCCAACCATCCTAAAATCCGCTCAGTTCTA
JMFF016K13+ CGAAAGCTTCAAAAAACGGGAAAACCCAAACCCAACCATCCTAAAATCCGCTCAGTTCTA
                      ____________________________________________________________
consensus CGAAAGCTTCAAAAAACGGGAAAACCCAAACCCAACCATCCTAAAATCCGCTCAGTTCTA
 
. : . : . : . : . : . :
JMFF002D03+ CAGCTTCAGAGCTCTTCTTCGACTGGTCCAGATGAGATGAGAAGTTTGGTATGCAGCGTT
JMSF007D24+ CAGCTTCAGAGCTCTTCTTCGACTGGTCCAGATGAGATGAGAAGTTTGGTATGCAGCGTT
JMFF016K13+ CAGCTTCAGAGCTCTTCTTCGACTGGTCCAGATGAGATGAGAAGTTTGGTATGCAGCGTT
                      ____________________________________________________________
consensus CAGCTTCAGAGCTCTTCTTCGACTGGTCCAGATGAGATGAGAAGTTTGGTATGCAGCGTT
 
. : . : . : . : . : . :
JMFF002D03+ GAACTGTAGAGGC
JMSF007D24+ GAACTGTAGAGGC
JMFF016K13+ GAACTGTAGAGGCATGGACTTTCAAAGCCGAAAGCTATTCCCCATTTGTTTTGTAATTCT
                      ____________________________________________________________
consensus GAACTGTAGAGGCATGGACTTTCAAAGCCGAAAGCTATTCCCCATTTGTTTTGTAATTCT