Previous Contig 000846:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016I06Sequence603000846 (2)gb:AY086794_15718374e-39Arabidopsis thaliana clone 27758 mRNA, complete sequence.804008968 (2)gb:AB017067_15134181e-86Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:AY059846_1564
JMFF034M19Sequence499000846 (2)gb:AY086794_15718373e-28Arabidopsis thaliana clone 27758 mRNA, complete sequence.663008968 (2)gb:AB017067_15134183e-60Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:AY059846_1564

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF016I06+ CCA
                      ____________________________________________________________
consensus CCA
 
. : . : . : . : . : . :
JMFF016I06+ AGAAAACCAAGAAATATATCACAGGTAGAGCTGTCTTGCCTGCGGAGAGAAAATCAAGCT
                      ____________________________________________________________
consensus AGAAAACCAAGAAATATATCACAGGTAGAGCTGTCTTGCCTGCGGAGAGAAAATCAAGCT
 
. : . : . : . : . : . :
JMFF034M19+ TTCATGGAAACCTCCAGAT
JMFF016I06+ GGCCCGTTTTGGGGTTGAAATTATACATAACAGACTGAACATTCATGGAAACCTCCAGAT
                      ____________________________________________________________
consensus GGCCCGTTTTGGGGTTGAAATTATACATAACAGACTGAACATTCATGGAAACCTCCAGAT
 
. : . : . : . : . : . :
JMFF034M19+ TGGGGATACAATTCGCGAACACCAGTGTGAATTGGTTTGCCTCCGAAACCTTGATGGAGG
JMFF016I06+ TGGGGATACAATTCGCGAACACCAGTGTGAATTGGTTTGCCTCCGAAACCTTGATGGAGG
                      ____________________________________________________________
consensus TGGGGATACAATTCGCGAACACCAGTGTGAATTGGTTTGCCTCCGAAACCTTGATGGAGG
 
. : . : . : . : . : . :
JMFF034M19+ CGCTGTACTCATGGGCAGAGGGTTTGATTTGGTCGAAGGTAAAAACCCTAGTGATAAGTT
JMFF016I06+ CGCTGTACTCATGGGCAGAGGGTTTGATTTGGTCGAAGGTAAAAACCCTAGTGATAAGTT
                      ____________________________________________________________
consensus CGCTGTACTCATGGGCAGAGGGTTTGATTTGGTCGAAGGTAAAAACCCTAGTGATAAGTT
 
. : . : . : . : . : . :
JMFF034M19+ CAGATTCGAGGGTGCACTGAATTTCCTTACTCTGGAACTGCTCGAGGACGTGCATCCAAG
JMFF016I06+ CAGATTCGAGGGTGCACTGAATTTCCTTACTCTGGAACTGCTCGAGGACGTGCATCCAAG
                      ____________________________________________________________
consensus CAGATTCGAGGGTGCACTGAATTTCCTTACTCTGGAACTGCTCGAGGACGTGCATCCAAG
 
. : . : . : . : . : . :
JMFF034M19+ TATCGAGAGTACAGAGGAAGAAACCGAGCTGGGAAAGGTGCGGATCGGGCTGGCCTTTTG
JMFF016I06+ TATCGAGAGTACAGAGGAAGAAACCGAGCTGGGAAAGGTGCGGATCGGGCTGGCCTTTTG
                      ____________________________________________________________
consensus TATCGAGAGTACAGAGGAAGAAACCGAGCTGGGAAAGGTGCGGATCGGGCTGGCCTTTTG
 
. : . : . : . : . : . :
JMFF034M19+ GAACGGAGAAGGAGAAGTCGGTGACGGAGAGGTTGAGACGGCCGGAGTGTGTGAAGCCGA
JMFF016I06+ GAACGGAGAAGGAGAAGTCGGTGACGGAGAGGTTGAGACGGCCGGAGTGTGTGAAGCCGA
                      ____________________________________________________________
consensus GAACGGAGAAGGAGAAGTCGGTGACGGAGAGGTTGAGACGGCCGGAGTGTGTGAAGCCGA
 
. : . : . : . : . : . :
JMFF034M19+ ATTCATCGAAAGGGATGGTGGATCGGGCGTCAGATCGGATCTCGGTGGACCGGATCTCAG
JMFF016I06+ ATTCATCGAAAGGGATGGTGGATCGGGCGTCAGATCGGATCTCGGTGGACCGGATCTCAG
                      ____________________________________________________________
consensus ATTCATCGAAAGGGATGGTGGATCGGGCGTCAGATCGGATCTCGGTGGACCGGATCTCAG
 
. : . : . : . : . : . :
JMFF034M19+ CAAAGGCGGTAGCAAACAAGAGAGCGAAGGCCAGAGTTGGCAAACAGAGACGCAGCCGGA
JMFF016I06+ CAAAGGCGGTAGCAAACAAGAGAGCGAAGGCCAGAGTTGGCAAACAGAGACGCAGCCGGA
                      ____________________________________________________________
consensus CAAAGGCGGTAGCAAACAAGAGAGCGAAGGCCAGAGTTGGCAAACAGAGACGCAGCCGGA
 
. : . : . : . : . : . :
JMFF034M19+ AATGAGCCATGGGAGTAGAATTTGGTCTTCCAGAGAGAAGAAAACTCACCGACGATCACC
JMFF016I06+ AATGAGCCATGGGAGTAGAATTTGGTCTTCCAGAGAGAAGAAAACTCACCGACGACCACC
                      ____________________________________________________________
consensus AATGAGCCATGGGAGTAGAATTTGGTCTTCCAGAGAGAAGAAAACTCACCGACGATCACC