Previous Contig 000843:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014H10Sequence538000843 (8)
JMFF016H09Sequence539000843 (8)
JMFF022G10Sequence491000843 (8)gb:AY088406_15734250.004Arabidopsis thaliana clone 6493 mRNA, complete sequence.715000843 (8)gb:AF088281_17672667e-52Arabidopsis thaliana phytochrome-associated protein 1 (PAP1) mRNA, complete cds.
JMSF020N08Sequence644000843 (8)785000843 (8)gb:AF088281_17672667e-52Arabidopsis thaliana phytochrome-associated protein 1 (PAP1) mRNA, complete cds.
JMSF040P03Sequence673000843 (8)sp|Q8LAL2|IAAQ_ARATH2e-09Auxin-responsive protein IAA26 (Indoleacetic acid-induced protein 26) (Phytochro758000843 (8)gb:AF088281_17672661e-40Arabidopsis thaliana phytochrome-associated protein 1 (PAP1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040P03- TGTTTATTTTTTNCTGAACATTGCTGCTTCNACTCAAAATT
                      ____________________________________________________________
consensus TGTTTATTTTTTNCTGAACATTGCTGCTTCNACTCAAAATT
 
. : . : . : . : . : . :
rJMSF040P03- TTATCCAAAAACATAGATGACTTACAAAAACAACTCANCACAATANTTGCAAAAGACTCT
                      ____________________________________________________________
consensus TTATCCAAAAACATAGATGACTTACAAAAACAACTCANCACAATANTTGCAAAAGACTCT
 
. : . : . : . : . : . :
rJMSF040P03- TCACACAAGAGGCTGCTTAGCTTCCTCNTTGTTAAGTNAGAGCTTCANCTGCTTCCCNCG
rJMFF022G10- AGCTTCACCTGCTTCCCACG
rJMSF020N08- AGCTTCACCTGCTTCCCACG
                      ____________________________________________________________
consensus TCACACAAGAGGCTGCTTAGCTTCCTCNTTGTTAAGTNAGAGCTTCACCTGCTTCCCACG
 
. : . : . : . : . : . :
rJMSF040P03- GNTNAGACTCGNGAGCTNAGAGGTTTTCAACACGCGCAGCCTCTTCACAGNCGACACAAA
rJMFF022G10- GCTTAGACTCGAGAGCTCAGAGGTTTTCAACACGCGCAGCCTCTTCACAGTCGACACAAA
rJMSF020N08- GCTTAGACTCGAGAGCTCAGAGGTTTTCAACACGCGCAGCCTCTTCACAGTCGACACAAA
                      ____________________________________________________________
consensus GCTTAGACTCGAGAGCTCAGAGGTTTTCAACACGCGCAGCCTCTTCACAGTCGACACAAA
 
. : . : . : . : . : . :
rJMSF040P03- CANTTGCCGNTGGACATCATCCCCAACGAGCATNGNGTCCCCTTCATTATCCTCGTAAAC
rJMFF022G10- CATTTGCCAATGGACATCATCCCCAACGAGCATCGTGTCCCCTTCATTATCCTCGTAAAC
rJMSF020N08- CATTTGCCAATGGACATCATCCCCAACGAGCATCGTGTCCCCTTCATTATCCTCGTAAAC
                      ____________________________________________________________
consensus CATTTGCCAATGGACATCATCCCCAACGAGCATCGTGTCCCCTTCATTATCCTCGTAAAC
 
. : . : . : . : . : . :
rJMSF040P03- NNGGGNATATTCNCCGCTTCCATCTAACAATCCAGTTATCGCTTTCTCTCCCCCTTCAGN
rJMFF022G10- CAGGGTATATTCCCCGCTTCCATCTAACAATCCAGTTATCGCTTTCTCTCCCCCTTCAGT
rJMSF020N08- CAGGGTATATTCCCCGCTTCCATCTAACAATCCAGTTATCGCTTTCTCTCCCCCTTCAGT
                      ____________________________________________________________
consensus CAGGGTATATTCCCCGCTTCCATCTAACAATCCAGTTATCGCTTTCTCTCCCCCTTCAGT
 
. : . : . : . : . : . :
rJMSF040P03- TNGAGCTGCAAGAAGGCCTTTAAAGAGTTCNTTGACAGNAGAAGCAAGTTTTTCGTAGCT
rJMFF022G10- TTGAGCTGCAAGAAGGCCTTTAAAGAGTTCATTGACAGCAGAAGCAAGTTTTTCGTAGCT
rJMSF020N08- TTGAGCTGCAAGAAGGCCTTTAAAGAGTTCATTGACAGCAGAAGCAAGTTTTTCGTAGCT
                      ____________________________________________________________
consensus TTGAGCTGCAAGAAGGCCTTTAAAGAGTTCATTGACAGCAGAAGCAAGTTTTTCGTAGCT
 
. : . : . : . : . : . :
rJMSF040P03- GTCANAGGCGCTGAGATCCACTTTTCTTCCAATCGGGATTCCATCNATGTTAATCTTAAC
rJMFF022G10- GTCATAGGCGCTGAGATCCACTTTTCTTCCAATCGGGATTCCATCCATGTTAATCTTAAC
rJMSF020N08- GTCATAGGCGCTGAGATCCACTTTTCTTCCAATCGGGATTCCATCCATGTTAATCTTAAC
                      ____________________________________________________________
consensus GTCATAGGCGCTGAGATCCACTTTTCTTCCAATCGGGATTCCATCCATGTTAATCTTAAC
 
. : . : . : . : . : . :
rJMSF040P03- AAAGAAACCTTNNTGGCTCCTTTCCNTCGGTTTTTCACTCGAAAANTTGTNCNAGACTGC
rJMFF022G10- AAAGAAACCTTTTTGGCTCCTTTCCATCGGTTTTTCACTCGAAAACTTGTTCGAGACTGC
rJMSF020N08- AAAGAAACCTTTTTGGCTCCTTTCCATCGGTTTTTCACTCGAAAACTTGTTCGAGACTGC
                      ____________________________________________________________
consensus AAAGAAACCTTTTTGGCTCCTTTCCATCGGTTTTTCACTCGAAAACTTGTTCGAGACTGC
 
. : . : . : . : . : . :
rJMSF040P03- ATNTNGTGACTCCGGGANTTGTTTNANAGAGCTGCTACTTGCAAGATTCTTNCTGAACGA
rJMFF022G10- ATTTTGTGACTCCGGGATTTGTTTCAGAGAGCTGCTACTTGCAAGATTCTTCCTGAACGA
rJMSF020N08- ATTTTGTGACTCCGGGATTTGTTTCAGAGAGCTGCTACTTGCAAGATTCTTCCTGAACGA
JMSF040P03+ AGAGCTGCTACNTGCAAGATTNTTCCTGAACGA
                      ____________________________________________________________
consensus ATTTTGTGACTCCGGGATTTGTTTCAGAGAGCTGCTACTTGCAAGATTCTTCCTGAACGA
 
. : . : . : . : . : . :
rJMSF040P03- ACGANGTGGCGGCCACCCCACAGCTGGAGAAGGAGCAGTCCTTTTCTGAGAGGTGNTTGG
rJMFF022G10- ACGAAGTGGCGGCCACCCCACAACTGGAGAAGGAGCAGTCCTTTTCTGAGAGGTGTTTGG
rJMSF020N08- ACGAAGTGGCGGCCACCCCACAACTGGAGAAGGAGCAGTCCTTTTCTGAGAGGTGTTTGG
JMSF040P03+ ACGAAGTGGCGGCCACCCCACAACTGGAGAAGGAGCAGTCCTTTTCTGAGAGGTGTTTGG
                      ____________________________________________________________
consensus ACGAAGTGGCGGCCACCCCACAACTGGAGAAGGAGCAGTCCTTTTCTGAGAGGTGTTTGG
 
. : . : . : . : . : . :
rJMSF040P03- CACAGCAGGTGGNGAANATGCCATCTTCNCTGAGCTGTTCAAGTCTACACCTTTAGAACA
rJMFF022G10- CACAGCAGGTGGTGAAAATGCCATCTTCTCTGAACTGTTCAAGTCTACACCTTTAGAA
rJMSF020N08- CACAGCAGGTGGTGAAAATGCCATCTTCTCTGAACTGTTCAAGTCTACACCTTTAGAACA
JMSF040P03+ CACAGCAGGTGGTGAAAATGCCATCTTCTCTGAACTGTTCAAGTCTACACCTTTAGAACA
                      ____________________________________________________________
consensus CACAGCAGGTGGTGAAAATGCCATCTTCTCTGAACTGTTCAAGTCTACACCTTTAGAACA
 
. : . : . : . : . : . :
rJMSF040P03- CCNAGGTTGTGATGGTTNCTGGGGCCTCANAGGCAAACNCTGGCTCTGGCTGG
rJMSF020N08- CCCAGGTTGTGATGGTTCCTGGGGCCTCACAGGCAAACACTGGCTCTGGCTGGGTGATTG
JMFF022G10+ GCCTCACAGGCAAACACTGGCTCTGGCTGGGTGATTG
JMSF040P03+ CCCAGGTTGTGATGGTTCCTGGGGCCTCACAGGCAAACACTGGCTCTGGCTGGGTGATTG
                      ____________________________________________________________
consensus CCCAGGTTGTGATGGTTCCTGGGGCCTCACAGGCAAACACTGGCTCTGGCTGGGTGATTG
 
. : . : . : . : . : . :
rJMSF020N08- AAGGCC-ANGAAGGATGAGAACTGATGGGGGGGTTGGGCTCCATTAACAGGAGCTTC
JMFF022G10+ AAGGCCAAGGAAGGATGAGAACTGATGGGGGGGTTGGGCTCCATTAACAGGAGCTTCCAA
JMSF040P03+ AAGGCCAAGGAAGGATGAGAACTGATGGGGGGGTTGGGCTCCATTAACAGGAGCTTCCAA
                      ____________________________________________________________
consensus AAGGCCAAGGAAGGATGAGAACTGATGGGGGGGTTGGGCTCCATTAACAGGAGCTTCCAA
 
. : . : . : . : . : . :
JMFF022G10+ GAACCCTCTCTTTGCAGAAGCACAGGAGAAATGGGTGAAGGAGAGGTGTGAATGTGAATC
JMSF040P03+ GAACCCTCTCTTTGCAGAAGCACAGGAGAAATGGGTGAAGGAGAGGTGTGAATGTGAATC
                      ____________________________________________________________
consensus GAACCCTCTCTTTGCAGAAGCACAGGAGAAATGGGTGAAGGAGAGGTGTGAATGTGAATC
 
. : . : . : . : . : . :
JMFF022G10+ ATCTCTTCCCCTAACCTTGGACCTATCTTTCACACACCACTCTCCATCTGGTGGACCAAG
JMSF040P03+ ATCTCTTCCCCTAACCTTGGACCTATCTTTCACACACCACTCTCCATCTGGTGGACCAAG
JMSF020N08+ CTAACCTTGGACCTATCTTTCACACACCACTCTCCATCTGGTGGACCAAG
                      ____________________________________________________________
consensus ATCTCTTCCCCTAACCTTGGACCTATCTTTCACACACCACTCTCCATCTGGTGGACCAAG
 
. : . : . : . : . : . :
JMFF022G10+ CCTCAGTTCCAGCTTTTTCTCTTCAGAAACCCCATGGCTTCTCCCTTCAAACAGAACCTT
JMSF040P03+ CCTCAGTTCCAGCTTTTTCTCTTCAGAAACCCCATGGCTTCTCCCTTCAAACAGAACCTT
JMSF020N08+ CCTCAGTTCCAGCTTTTTCTCTTCAGAAACCCCATGGCTTCTCCCTTCAAACAGAACCTT
                      ____________________________________________________________
consensus CCTCAGTTCCAGCTTTTTCTCTTCAGAAACCCCATGGCTTCTCCCTTCAAACAGAACCTT
 
. : . : . : . : . : . :
JMFF022G10+ ATTGCATTTCTCTTCCTTTCTTGAATATCCCTCCATGTTTTTTTTCCTGACAACACAAAA
JMSF040P03+ ATTGCATTTCTCTTCCTTTCTTGAATATCCCTCCATGTTTTTTTTCCTGACAACACAAAA
JMSF020N08+ ATTGCATTTCTCTTCCTTTCTTGAATATCCCTCCATGTTTTTTTTCCTGACAACACAAAA
                      ____________________________________________________________
consensus ATTGCATTTCTCTTCCTTTCTTGAATATCCCTCCATGTTTTTTTTCCTGACAACACAAAA
 
. : . : . : . : . : . :
JMFF022G10+ TAAACAAAAAAACCCACTCCACAGAGATCTTTCAATTAAAGCTGAAAGTTATAGACACCC
JMSF040P03+ TAAACAAAAAAACCCACTCCACAGAGATCTTTCAATTAAAGCTGAAAGTTATAGACACCC
JMSF020N08+ TAAACAAAAAAACCCACTCCACAGAGATCTTTCAATTAAAGCTGAAAGTTATAGACACCC
JMFF014H10+ CAATTAAAGCTGAAAGTTATAGACACCC
JMFF016H09+ CAATTAAAGCTGAAAGTTATAGACACCC
                      ____________________________________________________________
consensus TAAACAAAAAAACCCACTCCACAGAGATCTTTCAATTAAAGCTGAAAGTTATAGACACCC
 
. : . : . : . : . : . :
JMFF022G10+ CCATG-CCTCAACCTCAAGAACTGTGAAACCCAGACAGTGAAACCTGAATGGAGTGTGAC
JMSF040P03+ CCATG-CCTCAACCTCAAGAACTGTGAAACCCAGACAGTGAAACCTGAATGGAGTGTGAC
JMSF020N08+ CCATG-CCTCAACCTCAAGAACTGTGAAACCCAGACAGTGAAACCTGAATGGAGTGTGAC
JMFF014H10+ CCATGCCCTCAACCTCAAGAACTGTGAAACCCAGACAGTGAAACCTGAATGGAGTGTGAC
JMFF016H09+ CCATG-CCTCAACCTCAAGAACTGTGAAACCCAGACAGTGAAACCTGAATGGAGTGTGAC
                      ____________________________________________________________
consensus CCATG-CCTCAACCTCAAGAACTGTGAAACCCAGACAGTGAAACCTGAATGGAGTGTGAC
 
. : . : . : . : . : . :
JMFF022G10+ AGACTACAAGATGAAGAGCAAAGACAAGAAGAAAC
JMSF040P03+ AGACTACAAGATGAAGAGCAAAGACAAGAAGAAAC
JMSF020N08+ AGACTACAAGATGAAGAGCAAAGACAAGAAGAAACAGGGAAAACTACAAGTGAAGTGTTA
JMFF014H10+ AGACTACAAGATGAAGAGCAAAGACAAGAAGAAACAGGGAAAACTACAAGTGAAGTGTTA
JMFF016H09+ AGACTACAAGATGAAGAGCAAAGACAAGAAGAAACAGGGAAAACTACAAGTGAAGTGTTA
                      ____________________________________________________________
consensus AGACTACAAGATGAAGAGCAAAGACAAGAAGAAACAGGGAAAACTACAAGTGAAGTGTTA
 
. : . : . : . : . : . :
JMSF020N08+ GCTAAATAGGATTGTGATCCAAAGCTTTAATTTTAATTTCTCTGGTTTTCTTTATTACAA
JMFF014H10+ GCTAAATAGGATTGTGATCCAAAGCTTTAATTTTAATTTCTCTGGTTTTCTTTATTACAA
JMFF016H09+ GCTAAATAGGATTGTGATCCAAAGCTTTAATTTTAATTTCTCTGGTTTTCTTTATTACAA
                      ____________________________________________________________
consensus GCTAAATAGGATTGTGATCCAAAGCTTTAATTTTAATTTCTCTGGTTTTCTTTATTACAA
 
. : . : . : . : . : . :
JMSF020N08+ ACTTTCTGTCTTTTTGTTGGGAGTAAAGAAAGGCTGAAAGCAAGGGGATTAAAGATTGGA
JMFF014H10+ ACTTTCTGTCTTTTTGTTGGGAGTAAAGAAAGGCTGAAAGCAAGGGGATTAAAGATTGGA
JMFF016H09+ ACTTTCTGTCTTTTTGTTGGGAGTAAAGAAAGGCTGAAAGCAAGGGGATTAAAGATTGGA
                      ____________________________________________________________
consensus ACTTTCTGTCTTTTTGTTGGGAGTAAAGAAAGGCTGAAAGCAAGGGGATTAAAGATTGGA
 
. : . : . : . : . : . :
JMSF020N08+ AGAGATTAGAAGAAGGAGAAAGAATCTGTTTTTGTAAACGGAATTGGAGAAGTTCTCACA
JMFF014H10+ AGAGATTAGAAGAAGGAGAAAGAATCTGTTTTTGTAAACGGAATTGGAGAAGTTCTCACA
JMFF016H09+ AGAGATTAGAAGAAGGAGAAAGAATCTGTTTTTGTAAACGGAATTGGAGAAGTTCTCACA
                      ____________________________________________________________
consensus AGAGATTAGAAGAAGGAGAAAGAATCTGTTTTTGTAAACGGAATTGGAGAAGTTCTCACA
 
. : . : . : . : . : . :
JMSF020N08+ CAAGACGCAACCCTTGAAATTTGTTGTGATCCGTGGGCAAGGCAGCAAGCGTGCTCTGCT
JMFF014H10+ CAAGACGCAACCCTTGAAATTTGTTGTGATCCGTGGGCAAGGCAGCAAGCGTGCTCTGCT
JMFF016H09+ CAAGACGCAACCCTTGAAATTTGTTGTGATCCGTGGGCAAGGCAGCAAGCGTGCTCTGCT
                      ____________________________________________________________
consensus CAAGACGCAACCCTTGAAATTTGTTGTGATCCGTGGGCAAGGCAGCAAGCGTGCTCTGCT
 
. : . : . : . : . : . :
JMSF020N08+ GACTCTCTCTCTGTCTAGAAAAACAGATACCTCATTACTGTGTGTGAGAGAGAT
JMFF014H10+ GACTCTCTCTCTGTCTAGAAAAACAGATACCTCATTACTGTGTGTGAGAGAGATAGAGAC
JMFF016H09+ GACTCTCTCTCTGTCTAGAAAAACAGATACCTCATTACTGTGTGTGAGAGAGATAGAGAC
                      ____________________________________________________________
consensus GACTCTCTCTCTGTCTAGAAAAACAGATACCTCATTACTGTGTGTGAGAGAGATAGAGAC
 
. : . : . : . : . : . :
JMFF014H10+ TAGAGAGAGAAAAGAGACATTAATATACATATAGAATGACAATGACAGAATTCCTGAGAT
JMFF016H09+ TAGAGAGAGAAAAGAGACATTAATATACATATAGAATGACAATGACAGAATTCCTGAGAT
                      ____________________________________________________________
consensus TAGAGAGAGAAAAGAGACATTAATATACATATAGAATGACAATGACAGAATTCCTGAGAT