Previous Contig 000838:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016F06Sequence506000838 (2)gb:AP002866_18233688e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P041182010107 (2)
JMFF041C06Sequence643000838 (2)gb:AP002866_18233682e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P041620010107 (2)gb:AP004124_18379581e-23Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ16

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041C06+ CGTTTAATTCCGTCAATTATTGCGGCAACGACGTGAGGGACGA
                      ____________________________________________________________
consensus CGTTTAATTCCGTCAATTATTGCGGCAACGACGTGAGGGACGA
 
. : . : . : . : . : . :
JMFF041C06+ GAACCCTAACCTCTTCAATGGACCTTCCTTGGCGTAAGAAGGGGAAGTAGTCGTTCCCGC
                      ____________________________________________________________
consensus GAACCCTAACCTCTTCAATGGACCTTCCTTGGCGTAAGAAGGGGAAGTAGTCGTTCCCGC
 
. : . : . : . : . : . :
JMFF041C06+ CAAATTCTCCGAAAATGAAAAGCGAATCCTCGAGGCCTTTCGATCGCGAGGCGCGTGTTG
JMFF016F06+ GCCTTTCGATCGCGAGGCGCGTGTTG
                      ____________________________________________________________
consensus CAAATTCTCCGAAAATGAAAAGCGAATCCTCGAGGCCTTTCGATCGCGAGGCGCGTGTTG
 
. : . : . : . : . : . :
JMFF041C06+ GGGAAGCAGAGTTGAGGTGCGTCTCGAACCACTCCAATTGTTTGCTGATCGGGGGTTTGG
JMFF016F06+ GGGAAGCAGAGTTGAGGTGCGTCTCGAACCACTCCAATTGTTTGCTGATCGGGGGTTTGG
                      ____________________________________________________________
consensus GGGAAGCAGAGTTGAGGTGCGTCTCGAACCACTCCAATTGTTTGCTGATCGGGGGTTTGG
 
. : . : . : . : . : . :
JMFF041C06+ AATTCGAAATGCTAATGTTCCTCTTCGCGAAAAAGTCTCCGTCGAGCGCCGTTGCTCCGG
JMFF016F06+ AATTCGAAATGCTAATGTTCCTCTTCGCGAAAAAGTCTCCGTCGAGCGCCGTTGCTCCGG
                      ____________________________________________________________
consensus AATTCGAAATGCTAATGTTCCTCTTCGCGAAAAAGTCTCCGTCGAGCGCCGTTGCTCCGG
 
. : . : . : . : . : . :
JMFF041C06+ CGACGGCGAAATTAACGCCGTGAGCGAACGAACCGTTGGCGTTCAGGTAAGCGTCAAGGA
JMFF016F06+ CGACGGCGAAATTAACGCCGTGAGCGAACGAACCGTTGGCGTTCAGGTAAGCGTCAAGGA
                      ____________________________________________________________
consensus CGACGGCGAAATTAACGCCGTGAGCGAACGAACCGTTGGCGTTCAGGTAAGCGTCAAGGA
 
. : . : . : . : . : . :
JMFF041C06+ ACGGGAGCTTGAGAGCGGCGGCGATGAAGTCCACGATCAATCGCCCGTCGGAGTACCGGC
JMFF016F06+ ACGGGAGCTTGAGAGCGGCGGCGATGAAGTCCACGATCAATCGCCCGTCGGAGTACCGGC
                      ____________________________________________________________
consensus ACGGGAGCTTGAGAGCGGCGGCGATGAAGTCCACGATCAATCGCCCGTCGGAGTACCGGC
 
. : . : . : . : . : . :
JMFF041C06+ CCGTGGCTTTACCAAAATAGGTTTCACCGTAAGGGAGATTATTAGCGGGGTAAAACATAC
JMFF016F06+ CCGTGGCTTTACCAAAATAGGTTTCACCGTAAGGGAGATTATTAGCGGGGTAAAACATAC
                      ____________________________________________________________
consensus CCGTGGCTTTACCAAAATAGGTTTCACCGTAAGGGAGATTATTAGCGGGGTAAAACATAC
 
. : . : . : . : . : . :
JMFF041C06+ GCCCCCCGGGGAGGCGGAGCAAGTTTCCGGTGTCGGAGAGGGAATCGCCGAATTGGTAGA
JMFF016F06+ GCCCCCCGGGGAGGCGGAGCAAGTTTCCGGTGTCGGAGAGGGAATCGCCGAATTGGTAGA
                      ____________________________________________________________
consensus GCCCCCCGGGGAGGCGGAGCAAGTTTCCGGTGTCGGAGAGGGAATCGCCGAATTGGTAGA
 
. : . : . : . : . : . :
JMFF041C06+ TGCGTTTGAAGGAAGGAAGGGGCGGGGAGTTGGCAGCAAAGGCTAAAGGGAAGAGAAAGA
JMFF016F06+ TGCGTTTGAAGGAAGGAAGGGGCGGGGAGTTGGCAGCAAAGGCTAAAGGGAAGAGAAAGA
                      ____________________________________________________________
consensus TGCGTTTGAAGGAAGGAAGGGGCGGGGAGTTGGCAGCAAAGGCTAAAGGGAAGAGAAAGA
 
. : . : . : . : . : . :
JMFF041C06+ AAGCAGTGAGAAAGAAGGAAGAAGCCATTACAGGTTGCAGAATCTCTCCCACGCCTGAAC
JMFF016F06+ AAGCAGTGAGAAAGAAGGAAGAAGCCATTACAGGTTGCAGAATCTCTCCCACGCCTGAAC
                      ____________________________________________________________
consensus AAGCAGTGAGAAAGAAGGAAGAAGCCATTACAGGTTGCAGAATCTCTCCCACGCCTGAAC