Previous Contig 000822:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003K23Sequence190000822 (27)sp|P12062|CB26_PETSP3e-07Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37) 688000822 (27)gb:AC135564_1742598e-111Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence.
JMFF015P20Sequence529000822 (27)sp|P12062|CB26_PETSP8e-63Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37) 228000822 (27)
JMFF035D15Sequence560000822 (27)pir|T05938|T059383e-54chlorophyll a/b-binding protein type I precursor - barley>gb:HVLHCIITI_1682444 H708000822 (27)gb:AC135564_1742598e-109Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence.
JMFF036A14Sequence528000822 (27)sp|P12062|CB26_PETSP5e-76Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37) 774000822 (27)gb:AC135564_1742598e-127Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence.
JMFF036G18Sequence560000822 (27)sp|P12062|CB26_PETSP4e-82Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37) 341000822 (27)gb:STCHLABP_17227414e-43S.tuberosum gene for chlorophyll a/b binding protein type I.
JMFF042O15Sequence650000822 (27)sp|P12062|CB26_PETSPe-101Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37) 595000822 (27)gb:AC135564_17425982e-88Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence.
JMFF046E04Sequence555000822 (27)sp|P12062|CB26_PETSP9e-82Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37) 509000822 (27)gb:AC135564_17425984e-70Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence.
JMFF046K23Sequence575000822 (27)sp|P12062|CB26_PETSP5e-86Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37) 495000822 (27)gb:AC135564_17425983e-70Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence.
JMFF051D13Sequence581000822 (27)sp|P12062|CB26_PETSP1e-82Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37) 583000822 (27)gb:AC135564_17425981e-74Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence.
JMFN002A01Sequence564000822 (27)sp|P12062|CB26_PETSP5e-86Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37)
JMFN006M01Sequence627000822 (27)sp|P12062|CB26_PETSPe-101Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37)
JMFN011A04Sequence472000822 (27)sp|P27494|CB23_TOBAC5e-64Chlorophyll a-b binding protein 36, chloroplast precursor (LHCII type I CAB-36)
JMFN011G23Sequence511000822 (27)sp|P12062|CB26_PETSP2e-74Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37)
JMFN034B24Sequence566000822 (27)sp|P12062|CB26_PETSP1e-88Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37)
JMFN042A10Sequence634000822 (27)gb:AC135564_1742598e-118Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence.
JMFN046F23Sequence581000822 (27)sp|P12062|CB26_PETSP1e-91Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37)
JMFS109B10Sequence627000822 (27)gb:AC135564_1742598e-110Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence.
JMFS110A09Sequence627000822 (27)sp|P12062|CB26_PETSPe-101Chlorophyll a-b binding protein 37, chloroplast precursor (LHCII type I CAB-37)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF015P20- CTTTTTATTTCNCNATAATTTTGTATTTAATATTTATATTCAA
                      ____________________________________________________________
consensus CTTTTTATTTCNCNATAATTTTGTATTTAATATTTATATTCAA
 
. : . : . : . : . : . :
rJMFF015P20- GTGTTGATAATATTTGATATGGAATATATCCCAAATAATAATAATAAGGAGGAGGTTTGC
                      ____________________________________________________________
consensus GTGTTGATAATATTTGATATGGAATATATCCCAAATAATAATAATAAGGAGGAGGTTTGC
 
. : . : . : . : . : . :
rJMFF015P20- ATGGGCAAAAAGGGAAATGAAAAGGAGGAAACCATATTAACCCATAGAAGATAGTGGGAT
JMFN011A04+ CCATAGAAGATAGTGGGAT
rJMFF051D13- GGAGGAAACCATATTCA-CCATAGAAGATAGTGGGAT
rJMFF046E04- CCATAGAAGATAGTGGGAT
rJMFF046K23- ATAGTGGGAT
rJMFF042O15- CCATAGAAGATAGTGGGAT
rJMFF003K23- GTGGGAT
rJMFF035D15- AGTGGGAT
rJMFF036A14- TGGGAT
                      ____________________________________________________________
consensus ATGGGCAAAAAGGGAAATGAAAAGGAGGAAACCATATTCACCCATAGAAGATAGTGGGAT
 
. : . : . : . : . : . :
rJMFF015P20- TTTGCATTACTTTAACNGGAACAGAAAGGTAAATTCCCCATGCNGAAGAGGTAATTAAGT
JMFN011A04+ TTTGCATTACTTTAACAGGAACAGAAAGGTAAATT-CACATGCAGAAGAGGTAATTAAGT
rJMFF051D13- TTTGCATTACTTTAACAGGAACAGAAAGGTAAATT-CACATGCAGAAGAGGTAATTAAGT
rJMFF046E04- TTTGCATTACTTTAACAGGAACAGAAAGGTAAATT-CACATGCAGAAGAGGTAATTAAGT
rJMFF046K23- TTTGCATTACTTTAACAGGAACAGAAAGGTAAATT-CACATGCAGAAGAGGTAATTAAGT
rJMFF042O15- TTTGCATTACTTTAACAGGAACAGAAAGGTAAATT-CACATGCAGAAGAGGTAATTAAGT
JMFS109B10+ AGGTAATTAAGT
rJMFF003K23- TTTGCATTACTTTAACAGGAACAGAAAGGTAAATT-CACATGCAGAAGAGGTAATTAAGT
rJMFF035D15- TTTGCATTACTTTAACAGGAACAGAAAGGTAAATT-CACATGCAGAAGAGGTAATTAAGT
rJMFF036A14- TTTGCATTACTTTAACAGGAACAGAAAGGTAAATT-CACATGCAGAAGAGGTAATTAAGT
                      ____________________________________________________________
consensus TTTGCATTACTTTAACAGGAACAGAAAGGTAAATT-CACATGCAGAAGAGGTAATTAAGT
 
. : . : . : . : . : . :
rJMFF015P20- AATGA
JMFN011A04+ AATGACATCACTCATGATCATCAGTGATTTCACTTTCCGGGTACAAAGTTTGTAGCATAA
rJMFF051D13- AATGACATCACTCATGATCATCAGTGATTTCACTTTCCGGGTACAAAGTTTGTAGCATAA
rJMFF046E04- AATGACATCACTCATGATCATCAGTGATTTCACTTTCCGGGTACAAAGTTTGTAGCATAA
rJMFF046K23- AATGACATCACTCATGATCATCAGTGATTTCACTTTCCGGGTACAAAGTTTGTAGCATAA
rJMFF042O15- AATGACATCACTCATGATCATCAGTGATTTCACTTTCCGGGTACAAAGTTTGTAGCATAA
JMFS109B10+ AATGACATCACTCATGATCATCAGTGATTTCACTTTCCGGGTACAAAGTTTGTAGCATAA
rJMFF003K23- AATGACATCACTCATGATCATCAGTGATTTCACTTTCCGGGTACAAAGTTTGTAGCATAA
rJMFF035D15- AATGACATCACTCATGATCATCAGTGATTTCACTTTCCGGGTACAAAGTTTGTAGCATAA
JMFN042A10+ ATTTCACTTTCCGGGTACAAAGTTGNTAGCATAA
rJMFF036A14- AATGACATCACTCATGATCATCAGTGATTTCACTTTCCGGGTACAAAGTTTGTAGCATAA
                      ____________________________________________________________
consensus AATGACATCACTCATGATCATCAGTGATTTCACTTTCCGGGTACAAAGTTTGTAGCATAA
 
. : . : . : . : . : . :
JMFN011A04+ GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
rJMFF051D13- GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
rJMFF046E04- GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
rJMFF046K23- GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
rJMFF042O15- GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
JMFS109B10+ GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
rJMFF003K23- GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
rJMFF035D15- GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
JMFN042A10+ GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
rJMFF036A14- GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
                      ____________________________________________________________
consensus GCCCAAGCATTGTTAGCTACCGGGTCAGCAACGTGGTCGAAGAGGTTCTCAATCGGGCCC
 
. : . : . : . : . : . :
JMFN011A04+ TTTCCGGTAACAATGGCCTGCACGAAGAACCCGAACATGGAGAACATAGCCAAACGCCCG
rJMFF051D13- TTTCCGGTAACAATGGCCTGCACGAAGAACCCGAACATGGAGAACATAGCCAAACGCCCG
rJMFF046E04- TTTCCGGTAACAATGGCCTGCACGAGAAACCCGAACATGGAGAACATAGCCAAACGCCCG
rJMFF046K23- TTTCCGGTAACAATGGCCTGCACGAAGAACCCGAACATGGAGAACATAGCCAAACGCCCG
rJMFF042O15- TTTCCGGTAACAATGGCCTGCACGAAGAACCCGAACATGGAGAACATAGCCAAACGCCCG
rJMFF036G18- CAAACGCCCG
JMFS109B10+ TTTCCGGTAACAATGGCCTGCACGAAGAACCCGAACATGGAGAACATAGCCAAACGCCCG
rJMFF003K23- TTTCCGGTAACAATGGCCTGCACGAAGAACCCGAACATGGAGAACATAGCCAAACGCCCG
rJMFF035D15- TTTCCGGTAACAATGGCCTGCACGAAGAACCCGAACATGGAGAACATAGCCAAACGCCCG
JMFN042A10+ TTTCCGGTAACAATGGCCTGCACGAAGAACCCGAACATGGAGAACATAGCCAAACGCCCG
rJMFF036A14- TTTCCGGTAACAATGGCCTGCACGAAGAACCCGAACATGGAGAACATAGCCAAACGCCCG
                      ____________________________________________________________
consensus TTTCCGGTAACAATGGCCTGCACGAAGAACCCGAACATGGAGAACATAGCCAAACGCCCG
 
. : . : . : . : . : . :
JMFN011A04+ TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCATCGGCCAACCCCAGT
rJMFF051D13- TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCATCGGCCAACCCCAGT
rJMFF046E04- TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCATCGGCCAACCCCAGT
rJMFF046K23- TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCATCGGCCAACCCCAGT
rJMFF042O15- TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCATCGGCCAACCCCAGT
rJMFF036G18- TTCTTCAGTTCCTTCACTTTCNGCTCCNCGAACGCCTCCGGGTCATCGGNCAACCCCNGN
JMFS109B10+ TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCATCGGCCAACCCCAGT
rJMFF003K23- TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCATCGGCCAACCCCAGT
rJMFF035D15- TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCGAAGGCCAACCCCAGT
JMFN042A10+ TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCATCGGCCAACCCCAGT
rJMFF036A14- TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCATCGGCCAACCCCAGT
                      ____________________________________________________________
consensus TTCTTCAGTTCCTTCACTTTCAGCTCCGCGAACGCCTCCGGGTCATCGGCCAACCCCAGT
 
. : . : . : . : . : . :
JMFN011A04+ GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
rJMFF051D13- GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
rJMFF046E04- GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
rJMFF046K23- GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
rJMFF042O15- GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
rJMFF036G18- GGGNCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTNCGAGCGGGCCGCCGNCG
JMFS109B10+ GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
rJMFF003K23- GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
rJMFF035D15- GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
JMFN042A10+ GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
rJMFF036A14- GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
JMFS110A09+ CGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
JMFN006M01+ CGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
JMFN046F23+ GGGCCGCCGCCG
JMFF042O15+ TCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
                      ____________________________________________________________
consensus GGGTCGAAGGCGCCGCCGGGGTACACCTTGTCCAGCCCCTCTCCGAGCGGGCCGCCGCCG
 
. : . : . : . : . : . :
JMFN011A04+ ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
rJMFF051D13- ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
rJMFF046E04- ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
rJMFF046K23- ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
rJMFF042O15- ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
rJMFF036G18- ACTCTGTATCCCTCCACGAACCCCATCAGCACCANCTGGGAAGCCNAGATGGCNANGATG
JMFS109B10+ ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
rJMFF003K23- ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
rJMFF035D15- ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
JMFN042A10+ ACTCTGTATCCCTCCACGAACCCAATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
rJMFF036A14- ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
JMFS110A09+ ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
JMFN006M01+ ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
JMFN046F23+ ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
JMFF046K23+ CGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
JMFN034B24+ GTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
JMFN002A01+ CGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
JMFF042O15+ ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
JMFF051D13+ CGAACCCCATCAGCACCA-CTGGGAAGCCCAGATGGCCAGGATG
JMFF046E04+ GGAAGCCCAGATGGCCAGGATG
JMFF036G18+ GGAAGCCCAGATGGCCAGGATG
JMFF035D15+ GGGAAGCCCAGATGGCCAGGATG
                      ____________________________________________________________
consensus ACTCTGTATCCCTCCACGAACCCCATCAGCACCACCTGGGAAGCCCAGATGGCCAGGATG
 
. : . : . : . : . : . :
JMFN011A04+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAA
rJMFF051D13- CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
rJMFF046E04- CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
rJMFF046K23- CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
rJMFF042O15- CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
rJMFF036G18- CTCTGGGNGNGGATNANGNTTGGGTTGCCCAAGTANNCCAATCCGCCCTCCNAGAANATC
JMFS109B10+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
rJMFF003K23- CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
rJMFF035D15- CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFN042A10+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
rJMFF036A14- CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFS110A09+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFN006M01+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFN046F23+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFF046K23+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFN034B24+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFN002A01+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFF042O15+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFF051D13+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFF046E04+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFF036G18+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFN011G23+ TTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFF036A14+ GGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFF035D15+ CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
JMFF015P20+ GGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
                      ____________________________________________________________
consensus CTCTGGGCGTGGATCAGGTTTGGGTTGCCCAAGTAGTCCAATCCGCCCTCCGAGAAGATC
 
. : . : . : . : . : . :
rJMFF051D13- TGGGCTCCCGCCTTGAACCACACCGCC-T
rJMFF046E04- TGGGCTCCC
rJMFF046K23- TGGGCT
rJMFF042O15- TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
rJMFF036G18- TGGGCTCCCGCCTTGAACCACACCGCC-TCGACGAACTTCACGCCGTTCTTCNANAGGAT
JMFS109B10+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
rJMFF003K23- TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
rJMFF035D15- TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFN042A10+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
rJMFF036A14- TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFS110A09+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFN006M01+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFN046F23+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFF046K23+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFN034B24+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFN002A01+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFF042O15+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFF051D13+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFF046E04+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFF036G18+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFN011G23+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFF036A14+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFF035D15+ TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
JMFF015P20+ TGGGCTCCCGCCTTGAACCACACCGCCTTCGCCGAACTTCACGCCGTTCTTCGACAGGAT
                      ____________________________________________________________
consensus TGGGCTCCCGCCTTGAACCACACCGCC-TCGCCGAACTTCACGCCGTTCTTCGACAGGAT
 
. : . : . : . : . : . :
rJMFF042O15- TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGC
rJMFF036G18- TTCCNGGAACACGCAG
JMFS109B10+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
rJMFF003K23- TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
rJMFF035D15- TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFN042A10+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
rJMFF036A14- TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFS110A09+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFN006M01+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFN046F23+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFF046K23+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFN034B24+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFN002A01+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFF042O15+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFF051D13+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFF046E04+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFF036G18+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFN011G23+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFF036A14+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFF035D15+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
JMFF015P20+ TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
                      ____________________________________________________________
consensus TTCCGGGAACACGCAGCCCAGAGCGCCCAGCATGGCCCACCGGGAGTGGATCACCTCCAG
 
. : . : . : . : . : . :
JMFS109B10+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
rJMFF003K23- CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
rJMFF035D15- CTCGCGGTTCCTGGCGAANGTCTCTGGGTCCGCTGAAAG-CCGGCAGTGTCCCACCCGTA
JMFN042A10+ CTCGCGGTTCCTGGCGAAGGTCTCTGGATCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
rJMFF036A14- CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFS110A09+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFN006M01+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFN046F23+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFF046K23+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFN034B24+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFN002A01+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFF042O15+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFF051D13+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFF046E04+ CTGGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFF036G18+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFN011G23+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFF036A14+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
JMFF035D15+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAG-CCGGCAGTGTCCCACCCGTA
JMFF015P20+ CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
                      ____________________________________________________________
consensus CTCGCGGTTCCTGGCGAAGGTCTCTGGGTCCGCTGAAAGCCCGGCAGTGTCCCACCCGTA
 
. : . : . : . : . : . :
JMFS109B10+ GTCGCCGGGGAACTCG
rJMFF003K23- GTCGCCGGGGAACTCGCCGGTAA
rJMFF035D15- GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCC
JMFN042A10+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
rJMFF036A14- GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFS110A09+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFN006M01+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFN046F23+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFF046K23+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFN034B24+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFN002A01+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFF042O15+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFF051D13+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFF046E04+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFF036G18+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFN011G23+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFF036A14+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFF035D15+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
JMFF015P20+ GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
                      ____________________________________________________________
consensus GTCGCCGGGGAACTCGCCGGTAAGGTATGACGGAGTTTGCTCCGAGAATGGGCCCAAGTA
 
. : . : . : . : . : . :
JMFN042A10+ C
rJMFF036A14- CTTGGGGCGGTCCGGGCCATACCANATGCTCTGGGGGAGCACTTTTGACG
JMFS110A09+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFN006M01+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFN046F23+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFF046K23+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFN034B24+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFN002A01+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFF042O15+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFF051D13+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFF046E04+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFF036G18+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFN011G23+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFF036A14+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFF035D15+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
JMFF003K23+ GTACGCCTCA
JMFF015P20+ CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
                      ____________________________________________________________
consensus CTTGGGGCGGTCCGGGCCATACCAGATGCTCT-GGGGAGCACTTTTGACGGTACGCCTCA
 
. : . : . : . : . : . :
JMFS110A09+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFN006M01+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFN046F23+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFF046K23+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFN034B24+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFN002A01+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFF042O15+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFF051D13+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFF046E04+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFF036G18+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFN011G23+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFF036A14+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFF035D15+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFF003K23+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
JMFF015P20+ TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
                      ____________________________________________________________
consensus TGGTGAAGCGAGCACTGCCGGAGCTGCCGACCTTGCGGAGGAGATCGGTCTGGGACTTCA
 
. : . : . : . : . : . :
JMFS110A09+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFN006M01+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFN046F23+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFF046K23+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFN034B24+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFN002A01+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFF042O15+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFF051D13+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFF046E04+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFF036G18+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFN011G23+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFF036A14+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFF035D15+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFF003K23+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
JMFF015P20+ AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
                      ____________________________________________________________
consensus AGGCACTCTGCCCAGCAAATGCTGATTGTTGGATACCGCAACTCGCCATTGATGATGATT
 
. : . : . : . : . : . :
JMFS110A09+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGA
JMFN006M01+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGA
JMFN046F23+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTT
JMFF046K23+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTGCGAATGG
JMFN034B24+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGA
JMFN002A01+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCA
JMFF042O15+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTGCGAAAGGAT
JMFF051D13+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTGCGAATGGATGAAGT
JMFF046E04+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTGCGAATGGAT
JMFF036G18+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTGCGAATGGATGAAGT
JMFN011G23+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTG
JMFF036A14+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTGCGAATGGATGAAGT
JMFF035D15+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTGCGAATGGATGAAGT
JMFF003K23+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTGCGAATGGATGAAG
JMFF015P20+ CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTGCGAATGGATGAAGT
                      ____________________________________________________________
consensus CTTCTGCTCTTCTTAGCTTTCTGTTGGAGTTGATGGTATGCAGTTGCGAATGGATGAAGT