Previous Contig 000820:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015P12Sequence566000820 (3)705009873 (3)pir|F86296|F862962e-66hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF024J03Sequence496000820 (3)pir|F86296|F862963e-36hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido760009873 (3)pir|F86296|F862961e-81hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF035K24Sequence575000820 (3)pir|F86296|F862962e-53hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido641009873 (3)pir|F86296|F862962e-34hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF035K24+ CATGAATATCACTATGAGGAACCAGCAGCAGATCTTCATCATC
                      ____________________________________________________________
consensus CATGAATATCACTATGAGGAACCAGCAGCAGATCTTCATCATC
 
. : . : . : . : . : . :
JMFF035K24+ CAACCACCATGGTGCACACTATCCCGAGGATCCTTCTGGTTCTTTACACCAATCATCATG
                      ____________________________________________________________
consensus CAACCACCATGGTGCACACTATCCCGAGGATCCTTCTGGTTCTTTACACCAATCATCATG
 
. : . : . : . : . : . :
JMFF035K24+ AACGATAGAGTAGTAAAAAACAGAAAGTTTCCCAAGCTAACTCGAAGTACTGCATCAGTT
JMFF024J03+ AAGTTTCCCAAGCTAACTCGAAGTACTGCATCAGTT
                      ____________________________________________________________
consensus AACGATAGAGTAGTAAAAAACAGAAAGTTTCCCAAGCTAACTCGAAGTACTGCATCAGTT
 
. : . : . : . : . : . :
JMFF035K24+ CCAAACCATTCTCTATCTGGTGTTTGATGAAAATGATTAATCCACGGGATTTTCTCCATA
JMFF024J03+ CCAAACCATTCTCTATCTGGTGTTTGATGAAAATGATTAATCCACGGGATTTTCTCCATA
                      ____________________________________________________________
consensus CCAAACCATTCTCTATCTGGTGTTTGATGAAAATGATTAATCCACGGGATTTTCTCCATA
 
. : . : . : . : . : . :
JMFF035K24+ AAGGGAGCAGCAACCTCTCGAAGAATCCATGACACAATTAGTGAGAATGCAAAGAGACCA
JMFF024J03+ AAGGGAGCAGCAACCTCTCGAAGAATCCATGACACAATTAGTGAGAATGCAAAGAGACCA
                      ____________________________________________________________
consensus AAGGGAGCAGCAACCTCTCGAAGAATCCATGACACAATTAGTGAGAATGCAAAGAGACCA
 
. : . : . : . : . : . :
JMFF035K24+ CAATACGCAATCCGAGCTGACCGCCTGCTGATCCCTGACACCACCGTCCGGCAAGCATCG
JMFF024J03+ CAATACGCAATCCGAGCTGACCGCCTGCTGATCCCTGACACCACCGTCCGGCAAGCATCG
                      ____________________________________________________________
consensus CAATACGCAATCCGAGCTGACCGCCTGCTGATCCCTGACACCACCGTCCGGCAAGCATCG
 
. : . : . : . : . : . :
JMFF035K24+ CAAGCGCATGCAGCACAACACGATGCGAGACAAGATGCTGCCCACATCTTCAATTT----
JMFF024J03+ CAAGCGCATGCAGCACAACACGATGCGAGACAAGATGCTGCCCACATCTTCAATTTCAGG
                      ____________________________________________________________
consensus CAAGCGCATGCAGCACAACACGATGCGAGACAAGATGCTGCCCACATCTTCAATTTCAGG
 
. : . : . : . : . : . :
JMFF035K24+ -------TTGCGATTTGGACTTCCGCCAACCGTCCAACGCCACCGTCGAAAATAAATCTG
JMFF024J03+ AAGATACTTGCGATTTGGACTTCCGCCAACCGTCCAACGCCACCGTCGAAAATAAATCTG
JMFF015P12+ TTGCGATTTGGACTTCCGCCAACCGTCCAACGCCACCGTCGAAAATAAATCTG
                      ____________________________________________________________
consensus AAGATACTTGCGATTTGGACTTCCGCCAACCGTCCAACGCCACCGTCGAAAATAAATCTG
 
. : . : . : . : . : . :
JMFF035K24+ CTGCCCACCAAACTTCACCGTCGAAGAGAGTTGCTGTCCGCCGGCCGGAACAAAATCTTC
JMFF024J03+ CTGCCCACCAAACTTCACCGTCGAAGAGAGTTGCTGTCCGCCGGCCGGAACAAAATCTTC
JMFF015P12+ CTGCCCACCAAACTTCACCGTCGAAGAGAGTTGCTGTCCGCCGGCCGGAACAAAATCTTC
                      ____________________________________________________________
consensus CTGCCCACCAAACTTCACCGTCGAAGAGAGTTGCTGTCCGCCGGCCGGAACAAAATCTTC
 
. : . : . : . : . : . :
JMFF035K24+ TCTGATCGGAAAACTTTTCTAGAAAATCACCTCCGACCGAAATTGGTCCGGAGTGAGAT
JMFF024J03+ TCTGATCGGAAAACTTTTCTAGAAAATCACCTCCGACCGAAATTGGTCCGGAGTGAGAT
JMFF015P12+ TCTGATCGGAAAACTTTTCTAGAAAATCACCTCCGACCGAAATTGGTCCGGAGTGAGATT
                      ____________________________________________________________
consensus TCTGATCGGAAAACTTTTCTAGAAAATCACCTCCGACCGAAATTGGTCCGGAGTGAGATT
 
. : . : . : . : . : . :
JMFF015P12+ GACGATCCTTCTTCCTTGAAGCCGCCCTCTTTTATACTGCCTCCTCCGTACCTCCGAGCT
                      ____________________________________________________________
consensus GACGATCCTTCTTCCTTGAAGCCGCCCTCTTTTATACTGCCTCCTCCGTACCTCCGAGCT
 
. : . : . : . : . : . :
JMFF015P12+ TCGATGCACAAACCTCGCCGAACTGGAATCGGTCCATGCTGTCCGGGTTTCATGCTTGGC
                      ____________________________________________________________
consensus TCGATGCACAAACCTCGCCGAACTGGAATCGGTCCATGCTGTCCGGGTTTCATGCTTGGC
 
. : . : . : . : . : . :
JMFF015P12+ GAGTGGCGACGCTGAAAAAGCCTACGCCTCTCTCTCTCTCGTTCGCTTTTTACGATTGAC
                      ____________________________________________________________
consensus GAGTGGCGACGCTGAAAAAGCCTACGCCTCTCTCTCTCTCGTTCGCTTTTTACGATTGAC