Previous Contig 000813:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015N21Sequence426000813 (2)401000813 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF015N21+ ACCATG
JMFF015N21- ACCATG
                      ____________________________________________________________
consensus ACCATG
 
. : . : . : . : . : . :
rJMFF015N21+ GAATACAGGATGAAGGCACCTGCACTTGTACTCTTCATTCTCTTCCTGTTCTTCATATCT
JMFF015N21- GAATACAGGATGAAGGCACCTGCACTTGTACTCTTCATTCTCTTCCTGTTCTTCATATCT
                      ____________________________________________________________
consensus GAATACAGGATGAAGGCACCTGCACTTGTACTCTTCATTCTCTTCCTGTTCTTCATATCT
 
. : . : . : . : . : . :
rJMFF015N21+ CCAGCAAGTGTTGAGAGCTTCAATGGCGTCAACTCTATCAACTTTCTCCGCGAGAATGTG
JMFF015N21- CCAGCAAGTGTTGAGAGCTTCAATGGCGTCAACTCTATCAACTTTCTCCGCGAGAATGTG
                      ____________________________________________________________
consensus CCAGCAAGTGTTGAGAGCTTCAATGGCGTCAACTCTATCAACTTTCTCCGCGAGAATGTG
 
. : . : . : . : . : . :
rJMFF015N21+ AAGTATGGAGTTGAAGAAAGTAGGGGAAGAAGAAAGATGGTGGTGGAGATTGAAGCTATC
JMFF015N21- AAGTATGGAGTTGAAGAAAGTAGGGGAAGAAGAAAGATGGTGGTGGAGATTGAAGCTATC
                      ____________________________________________________________
consensus AAGTATGGAGTTGAAGAAAGTAGGGGAAGAAGAAAGATGGTGGTGGAGATTGAAGCTATC
 
. : . : . : . : . : . :
rJMFF015N21+ TTAGACTACGATAATGCAGGGCCTAACACTAAGCATGATCCTAAAGGGAAGAAAACTGGC
JMFF015N21- TTAGACTACGATAATGCAGGGCCTAACACTAAGCATGATCCTAAAGGGAAGAAAACTGGC
                      ____________________________________________________________
consensus TTAGACTACGATAATGCAGGGCCTAACACTAAGCATGATCCTAAAGGGAAGAAAACTGGC
 
. : . : . : . : . : . :
rJMFF015N21+ GGCGGCGCCGGCGGCAAGAACCCCTGATTCTACGCCTCTAACCACCACCCGGCGACCTGG
JMFF015N21- GGCGGCGCCGGCGGCAAGAACCCCTGATTCTACGCCTCTAACCACCACCCGGCGACCTGG
                      ____________________________________________________________
consensus GGCGGCGCCGGCGGCAAGAACCCCTGATTCTACGCCTCTAACCACCACCCGGCGACCTGG
 
. : . : . : . : . : . :
rJMFF015N21+ CCTGGCTAGCTTTATTAATTATGAATGAATCTGAGTTTCTTTGCAATTAGCTACAAATTA
JMFF015N21- CCTGGCTAGCTTTATTAATTATGAATGAATCTGAGTTTCTTTGCAATTAGCTACAAATTA
                      ____________________________________________________________
consensus CCTGGCTAGCTTTATTAATTATGAATGAATCTGAGTTTCTTTGCAATTAGCTACAAATTA
 
. : . : . : . : . : . :
rJMFF015N21+ AACTATATTATTATTCTTTAATGATAAAAAGCCT
JMFF015N21- AACTATATTATTATTCTTTAATGATAAAAAGCCTTACAGTTATTACCTACAAAAAAAAAA
                      ____________________________________________________________
consensus AACTATATTATTATTCTTTAATGATAAAAAGCCTTACAGTTATTACCTACAAAAAAAAAA