Previous Contig 000812:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015M11Sequence529000812 (2)gb:AY065264_15664144e-24Arabidopsis thaliana unknown protein (At1g02160) mRNA, complete cds.>gb:BT001907513000812 (2)gb:AY065264_15664144e-24Arabidopsis thaliana unknown protein (At1g02160) mRNA, complete cds.>gb:BT001907

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF015M11+ AAGAGAGAGAAAGGAAGTGGCGATGGAGTCTTCGAAGTATCAGGCACCG
JMFF015M11- AAGAGAGAGAAAGGAAGTGGCGATGGAGTCTTCGAAGTATCAGGCACCG
                      ____________________________________________________________
consensus AAGAGAGAGAAAGGAAGTGGCGATGGAGTCTTCGAAGTATCAGGCACCG
 
. : . : . : . : . : . :
rJMFF015M11+ CCTTATCCAAGTGCGGCGAAGCTCGCAGATTCCGACTGCTATCCTCAATACACTGCCTCA
JMFF015M11- CCTTATCCAAGTGCGGCGAAGCTCGCAGATTCCGACTGCTATCCTCAATACACTGCCTCA
                      ____________________________________________________________
consensus CCTTATCCAAGTGCGGCGAAGCTCGCAGATTCCGACTGCTATCCTCAATACACTGCCTCA
 
. : . : . : . : . : . :
rJMFF015M11+ CTAAAATGTTTAGAAGAATTTCACACGGACAAGAGTAAATGCCAGGAACATTTTGACAAT
JMFF015M11- CTAAAATGTTTAGAAGAATTTCACACGGACAAGAGTAAATGCCAGGAACATTTTGACAAT
                      ____________________________________________________________
consensus CTAAAATGTTTAGAAGAATTTCACACGGACAAGAGTAAATGCCAGGAACATTTTGACAAT
 
. : . : . : . : . : . :
rJMFF015M11+ TACAAGGAATGCAAGAAAAAGGAGAGAGAAGCTCGGCTGGAGCGTAATAGAAGTCGTTCT
JMFF015M11- TACAAGGAATGCAAGAAAAAGGAGAGAGAAGCTCGGCTGGAGCGTAATAGAAGTCGTTCT
                      ____________________________________________________________
consensus TACAAGGAATGCAAGAAAAAGGAGAGAGAAGCTCGGCTGGAGCGTAATAGAAGTCGTTCT
 
. : . : . : . : . : . :
rJMFF015M11+ TTCTTCTCATGAAAACTCTGTTTTGATATTGATTAAAGGAGTGTTTGGTATTCCAATTAC
JMFF015M11- TTCTTCTCATGAAAACTCTGTTTTGATATTGATTAAAGGAGTGTTTGGTATTCCAATTAC
                      ____________________________________________________________
consensus TTCTTCTCATGAAAACTCTGTTTTGATATTGATTAAAGGAGTGTTTGGTATTCCAATTAC
 
. : . : . : . : . : . :
rJMFF015M11+ TCAATGCCCCAGTGTATTTCATATAGATTGCTGAAACCTCCCTTTCTTTAAAGGCAGTTT
JMFF015M11- TCAATGCCCCAGTGTATTTCATATAGATTGCTGAAACCTCCCTTTCTTTAAAGGCAGTTT
                      ____________________________________________________________
consensus TCAATGCCCCAGTGTATTTCATATAGATTGCTGAAACCTCCCTTTCTTTAAAGGCAGTTT
 
. : . : . : . : . : . :
rJMFF015M11+ GGCTCGAATTACAGAGGCTAATAACGTATTCTCAGTATAACTCTAGAGTAATGTGGATGT
JMFF015M11- GGCTCGAATTACAGAGGCTAATAACGTATTCTCAGTATAACTCTAGAGTAATGTGGATGT
                      ____________________________________________________________
consensus GGCTCGAATTACAGAGGCTAATAACGTATTCTCAGTATAACTCTAGAGTAATGTGGATGT
 
. : . : . : . : . : . :
rJMFF015M11+ TGATAAGCTGTATTATTGCATTTACCTATAGATGTTGAACATTGTGGTACACGTGATTAG
JMFF015M11- TGATAAGCTGTATTATTGCATTTACCTATAGATGTTGAACATTGTGGTACACGTGATTAG
                      ____________________________________________________________
consensus TGATAAGCTGTATTATTGCATTTACCTATAGATGTTGAACATTGTGGTACACGTGATTAG
 
. : . : . : . : . : . :
rJMFF015M11+ TAATTTTGTCTTTTAGGTAACTTGCTTCTTGCCTTAATGCATAT
JMFF015M11- TAATTTTGTCTTTTAGGTAACTTGCTTCTTGCCTTAATGCATATTGATGGGATTATTCCT
                      ____________________________________________________________
consensus TAATTTTGTCTTTTAGGTAACTTGCTTCTTGCCTTAATGCATATTGATGGGATTATTCCT