Previous Contig 000809:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015L22Sequence522000809 (3)gb:ATAC011437_15432884e-24Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequenc711008936 (3)gb:ATAC011437_15432881e-43Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequenc
JMFF039K21Sequence556000809 (3)gb:ATAC011437_15432881e-27Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequenc714008936 (3)gb:ATAC011437_15432888e-40Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequenc
JMSF004K02Sequence417000809 (3)gb:ATAC011437_15432883e-10Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequenc544008936 (3)gb:ATAC011437_15432882e-26Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF039K21+ TCCTATTCAACATCCT
                      ____________________________________________________________
consensus TCCTATTCAACATCCT
 
. : . : . : . : . : . :
JMFF039K21+ GTTAGCTTCCTCAACCCTATTCAGTTTACAGAATCCGCTAATCAAAACATTATATGTAAC
JMFF015L22+ ATTCAGTTTACAGAATCCGCTAATCAAAACATTATATGTAAC
                      ____________________________________________________________
consensus GTTAGCTTCCTCAACCCTATTCAGTTTACAGAATCCGCTAATCAAAACATTATATGTAAC
 
. : . : . : . : . : . :
JMFF039K21+ AGCATTTGGCTCCCCAAATTGCTCCAGAATCTGCATCACTTTCACTGCCTTTTCAGCTTT
JMSF004K02+ TT
JMFF015L22+ AGCATTTGGCTCCCCAAATTGCTCCAGAATCTGCATCACTTTCACTGCCTTTTCAGCTTT
                      ____________________________________________________________
consensus AGCATTTGGCTCCCCAAATTGCTCCAGAATCTGCATCACTTTCACTGCCTTTTCAGCTTT
 
. : . : . : . : . : . :
JMFF039K21+ CTTAACCCTAAAAAGCCCCTTGATAAGCTTTGTACAGAGAACCACATCGGGTTTGTACCC
JMSF004K02+ CTTAACCCTAAAAAGCCCCTTGATAAGCTTTGTACAGAGAACCACATCGGGTTTGTACCC
JMFF015L22+ CTTAACCCTAAAAAGCCCCTTGATAAGCTTTGTACAGAGAACCACATCGGGTTTGTACCC
                      ____________________________________________________________
consensus CTTAACCCTAAAAAGCCCCTTGATAAGCTTTGTACAGAGAACCACATCGGGTTTGTACCC
 
. : . : . : . : . : . :
JMFF039K21+ GATCTTCACCATGGATTCAAGATGATACAGAGCTTCGCCATATTTCCCTGCCCCGCAAGA
JMSF004K02+ GATCTTCACCATGGATTCAAGATGATACAGAGCTTCGCCATATTTCCCTGCCCCGCAAGA
JMFF015L22+ GATCTTCACCATGGATTCAAGATGATACAGAGCTTCGCCATATTTCCCTGCCCCGCAAGA
                      ____________________________________________________________
consensus GATCTTCACCATGGATTCAAGATGATACAGAGCTTCGCCATATTTCCCTGCCCCGCAAGA
 
. : . : . : . : . : . :
JMFF039K21+ CCTATACAGCGCTCTCTTAATGTCGGCTTCTTTGAAATCGTTTGGCTGCGATAAGGTATT
JMSF004K02+ CCTATACAGCGCTCTCTTAATGTCGGCTTCTTTGAAATCGTTTGGCTGCGATAAGGTATT
JMFF015L22+ CCTATACAGCGCTCTCTTAATGTCGGCTTCTTTGAAATCGTTTGGCTGCGATAAGGTATT
                      ____________________________________________________________
consensus CCTATACAGCGCTCTCTTAATGTCGGCTTCTTTGAAATCGTTTGGCTGCGATAAGGTATT
 
. : . : . : . : . : . :
JMFF039K21+ TCTGTAGTTCTCGGTGGAAAGGTGGAGTCTTTGTATGGGGTTTCGGTTCCTAAATTCATG
JMSF004K02+ TCTGTAGTTCTCGGTGGAAAGGTGGAGTCTTTGTATGGGGTTTCGGTTCCTAAATTCATG
JMFF015L22+ TCTGTAGTTCTCGGTGGAAAGGTGGAGTCTTTGTATGGGGTTTCGGTTCCTAAATTCATG
                      ____________________________________________________________
consensus TCTGTAGTTCTCGGTGGAAAGGTGGAGTCTTTGTATGGGGTTTCGGTTCCTAAATTCATG
 
. : . : . : . : . : . :
JMFF039K21+ GCTTCTTCTGCATTTCACTGCAGAGGTGCTGCGGTTGCGATTTGTGGTGGGTTGGAGTTT
JMSF004K02+ GCTTCTTCTGCATTTCACTGCAGAGGTGCTGCGGTTGCGATTTGTGGTGGGTTGGAGTTT
JMFF015L22+ GCTTCTTCTGCATTTCACTGCAGAGGTGCTGCGGTTGCGATTTGTGGTGGGTTGGAGTTT
                      ____________________________________________________________
consensus GCTTCTTCTGCATTTCACTGCAGAGGTGCTGCGGTTGCGATTTGTGGTGGGTTGGAGTTT
 
. : . : . : . : . : . :
JMFF039K21+ CTTGAAGAAGAGAGGAGTGTGAGGGAAGAGGTGATTAGACAAGGAAACTGTCATGGGGTT
JMSF004K02+ CTTGAAGAAGAGAGGAGTGCGAGGGAAGAGGTGATTAGACAAGGAAACTGTCATGGGGTT
JMFF015L22+ CTTGAAGAAGAGAGGAGTGTGAGGGAAGAGGTGATTAGACAAGGAAACTGTCATGGGGTT
                      ____________________________________________________________
consensus CTTGAAGAAGAGAGGAGTGTGAGGGAAGAGGTGATTAGACAAGGAAACTGTCATGGGGTT
 
. : . : . : . : . : . :
JMFF039K21+ AGTGTTTCTTGATGTTCATGGAGAAATGAAGCACCTGAGAAGCTGTGTTCGCA
JMSF004K02+ AGTGTTTCTTGATGTTCATGGAGAAATGAAGCACCTGAGAAGCTGTGTTCGCA
JMFF015L22+ AGTGTTTCTTGATGTTCATGGAGAAATGAAGCACCTGAGAAGCTGTGTTCGCAGAATCTC
                      ____________________________________________________________
consensus AGTGTTTCTTGATGTTCATGGAGAAATGAAGCACCTGAGAAGCTGTGTTCGCAGAATCTC