Previous Contig 000808:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009P15Sequence542000808 (17)gb:AY086285_15713385e-37Arabidopsis thaliana clone 23407 mRNA, complete sequence.
JMFF015L20Sequence569000808 (17)gb:AY086285_15713381e-34Arabidopsis thaliana clone 23407 mRNA, complete sequence.724000808 (17)sp|Q94KK7|SY52_ARATH1e-66Syntaxin 52 (AtSYP52).>gb:BT003941_1637064 Arabidopsis thaliana clone RAFL15-10-
JMFN003F24Sequence616000808 (17)gb:AY086285_15713381e-47Arabidopsis thaliana clone 23407 mRNA, complete sequence.
JMFN011J17Sequence611000808 (17)gb:AY086285_15713388e-45Arabidopsis thaliana clone 23407 mRNA, complete sequence.
JMFS084H07Sequence589000808 (17)gb:AP005415_18514362e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMSF004N15Sequence198000808 (17)
JMSF009N14Sequence314000808 (17)gb:AP004084_18374661e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12788000808 (17)gb:AP005415_18514361e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMSF010N14Sequence690000808 (17)sp|Q9SA23|SY51_ARATH9e-63Syntaxin 51 (AtSYP51).>pir|C86297|C86297 hypothetical protein F3O9.4 - Arabidops
JMSF025J15Sequence691000808 (17)pir|C96827|C968271e-58protein F20B17.2 [imported] - Arabidopsis thaliana>gb:AE005173_895480 Arabidopsi753000808 (17)sp|Q94KK7|SY52_ARATH8e-74Syntaxin 52 (AtSYP52).>gb:BT003941_1637064 Arabidopsis thaliana clone RAFL15-10-
JMSF028C18Sequence675000808 (17)pir|C96827|C968275e-56protein F20B17.2 [imported] - Arabidopsis thaliana>gb:AE005173_895480 Arabidopsi755000808 (17)sp|Q94KK7|SY52_ARATH2e-70Syntaxin 52 (AtSYP52).>gb:BT003941_1637064 Arabidopsis thaliana clone RAFL15-10-
JMSF041P06Sequence780000808 (17)sp|Q94KK7|SY52_ARATH2e-72Syntaxin 52 (AtSYP52).>gb:BT003941_1637064 Arabidopsis thaliana clone RAFL15-10-558000808 (17)gb:AP005415_18514366e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMSF042P06Sequence612000808 (17)gb:AP005415_18514362e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS084H07- GAGAACTAGTCTCGTTTTTTTTTTTTTTTTTTCCTTCAAAATAA
                      ____________________________________________________________
consensus GAGAACTAGTCTCGTTTTTTTTTTTTTTTTTTCCTTCAAAATAA
 
. : . : . : . : . : . :
JMFS084H07- CACACGTGAAATTTTGCATTTTACTCAGAAACTTT-GTCCA-GTCCACCAAAGAAACAAA
rJMSF010N14- ATTTTGCATTTTACTCAGAAACTTTGGTCCAGGTCCACCAAAGAAACAAA
rJMFF015L20- ATTTTGCATTTTACTCAGAAACTTT-GTCCA-GTCCACCAAAGAAACAAA
rJMSF041P06- AGAAACAAA
rJMSF025J15- GTCCAGGTCCACCAAAGAAACAAA
rJMSF028C18- GTCCAGGTCCACCAAAGAAACAAA
rJMSF042P06- CTTT-GTCCAGGTCCACCAAAGAAACAAA
rJMSF009N14- ATTTTGCATTTTACTCAGAAACTTT-GTCCAGGTCCACCAAAGAAACAAA
                      ____________________________________________________________
consensus CACACGTGAAATTTTGCATTTTACTCAGAAACTTT-GTCCAGGTCCACCAAAGAAACAAA
 
. : . : . : . : . : . :
JMFS084H07- TAGCAAGACAGACACATTCCATAAGGAACAACTAAACAAGATACAATCACGGCCGCCCTG
rJMSF010N14- TAGCAAGACAGACACATTCCATAAGGAACAACTAAACAAGATACAATCACGGCCGCCCTG
rJMFF015L20- TAGCAAGACAGACACATTCCATAAGGAACAACTAAACAAGATACAATCACGGCCGCCCTG
rJMSF041P06- TAGCAAGACAGACACATTCCATAAGGAACAACTAAACAAGATACAATCACGGCCGCCCTG
rJMSF025J15- TAGCAAGACAGACACATTCCATAAGGAACAACTAAACAAGATACAATCACGGCCGCCCTG
rJMSF028C18- TAGCAAGACAGACACATTCCATAAGGAACAACTAAACAAGATACAATCACGGCCGCCCTG
rJMSF042P06- TAGCAAGACAGACACATTCCATAAGGAACAACTAAACAAGATACAATCACGGCCGCCCTG
rJMSF009N14- TAGCAAGACAGACACATTCCATAAGGAACAACTAAACAAGATACAATCACGGCCGCCCTG
                      ____________________________________________________________
consensus TAGCAAGACAGACACATTCCATAAGGAACAACTAAACAAGATACAATCACGGCCGCCCTG
 
. : . : . : . : . : . :
JMFS084H07- GCCAATATTAAGTTATTCCATACACAGGCAAAGATGCGTGTCAAACTGTAAAATACAAGC
rJMSF010N14- GCCAATATTAAGTTATTCCATACACAGGCAAAGATGCGTGTCAAACTGTAAAATACAAGC
rJMFF015L20- GCCAATATTAAGTTATTCCATACACAGGCAAAGATGCGTGTCAAACTGTAAAATACAAGC
rJMSF041P06- GCCAATATTAAGTTATTCCATACACAGGCAAAGATGCGTGTCAAACTGTAAAATACAAGC
rJMSF025J15- GCCAATATTAAGTTATTCCATACACAGGCAAAGATGCGTGTCAAACTGTAAAATACAAGC
rJMSF028C18- GCCAATATTAAGTTATTCCATACACAGGCAAAGATGCGTGTCAAACTGTAAAATACAAGC
rJMSF042P06- GCCAATATTAAGTTATTCCATACACAGGCAAAGATGCGTGTCAAACTGTAAAATACAAGC
rJMSF009N14- GCCAATATTAAGTTATTCCATACACAGGCAAAGATGCGTGTCAAACTGTAAAATACAAGC
                      ____________________________________________________________
consensus GCCAATATTAAGTTATTCCATACACAGGCAAAGATGCGTGTCAAACTGTAAAATACAAGC
 
. : . : . : . : . : . :
JMFS084H07- TTCGGCATTACAAGAATTTGAACAGCATATATATCACTGCGATCAGAACCACAATCCCAA
rJMSF010N14- TTCGGCATTACAAGAATTTGAACAGCATATATATCACTGCGATCAGAACCACAATCCCAA
rJMFF015L20- TTCGGCATTACAAGAATTTGAACAGCATATATATCACTGCGATCAGAACCACAATCCCAA
rJMSF041P06- TTCGGCATTACAAGAATTTGAACAGCATATATATCACTGCGATCAGAACCACAATCCCAA
rJMSF025J15- TTCGGCATTACAAGAATTTGAACAGCATATATATCACTGCGATCAGAACCACAATCCCAA
rJMSF028C18- TTCGGCATTACAAGAATTTGAACAGCATATATATCACTGCGATCAGAACCACAATCCCAA
rJMSF042P06- TTCGGCATTACAAGAATTTGAACAGCATATATATCACTGCGATCAGAACCACAATCCCAA
rJMSF009N14- TTCGGCATTACAAGAATTTGAACAGCATATATATCACTGCGATCAGAACCACAATCCCAA
                      ____________________________________________________________
consensus TTCGGCATTACAAGAATTTGAACAGCATATATATCACTGCGATCAGAACCACAATCCCAA
 
. : . : . : . : . : . :
JMFS084H07- TGACTGACATAAGCATGCACATGCAGGAGCACCCACCCTTTGTGCGCTTGTTTAAAATTG
rJMSF010N14- TGACTGACATAAGCATGCACATGCAGGAGCACCCACCCTTTGTGCGCTTGTTTAAAATTG
rJMFF015L20- TGACTGACATAAGCATGCACATGCAGGAGCACCCACCCTTTGTGCGCTTGTTTAAAATTG
rJMSF041P06- TGACTGACATAAGCATGCACATGCAGGAGCACCCACCCTTTGTGCGCTTGTTTAAAATTG
rJMSF025J15- TGACTGACATAAGCATGCACATGCAGGAGCACCCACCCTTTGTGCGCTTGTTTAAAATTG
rJMSF028C18- TGACTGACATAAGCATGCACATGCAGGAGCACCCACCCTTTGTGCGCTTGTTTAAAATTG
rJMSF042P06- TGACTGACATAAGCATGCACATGCAGGAGCACCCACCCTTTGTGCGCTTGTTTAAAATTG
rJMSF009N14- TGACTGACATAAGCATGCACATGCAGGAGCACCCACCCTTTGTGCGCTTGTTTAAAATTG
                      ____________________________________________________________
consensus TGACTGACATAAGCATGCACATGCAGGAGCACCCACCCTTTGTGCGCTTGTTTAAAATTG
 
. : . : . : . : . : . :
JMFS084H07- CAAGCCTCTTTTGTACTCGCTGTAGACGGGAGTCTGTAACATCAACATGTTCGTCCAGGT
rJMSF010N14- CAAGCCTCTTTTGTACTCGCTGTAGACGGGAGTCTGTAACATCAACATGTTCGTCCAGGT
rJMFF015L20- CAAGCCTCTTTTGTACTCGCTGTAGACGGGAGTCTGTAACATCAACATGTTCGTCCAGGT
rJMSF041P06- CAAGCCTCTTTTGTACTCGCTGTAGACGGGAGTCTGTAACATCAACATGTTCGTCCAGGT
rJMSF025J15- CAAGCCTCTTTTGTACTCGCTGTAGACGGGAGTCTGTAACATCAACATGTTCGTCCAGGT
rJMSF028C18- CAAGCCTCTTTTGTACTCGCTGTAGACGGGAGTCTGTAACATCAACATGTTCGTCCAGGT
rJMSF042P06- CAAGCCTCTTTTGTACTCGCTGTAGACGGGAGTCTGTAACATCAACATGTTCGTCCAGGT
rJMSF009N14- CAAGCCTCTTTTGTACTCGCTGTAGACGGGAGTCTGTAACATCAACATGTTCGTCCAGGT
JMSF041P06+ TGTACTCGCTGTAGACGGGAGTCTGTAACATCAACATGTTCGTCCAGGT
                      ____________________________________________________________
consensus CAAGCCTCTTTTGTACTCGCTGTAGACGGGAGTCTGTAACATCAACATGTTCGTCCAGGT
 
. : . : . : . : . : . :
JMFS084H07- CATCAATGAGTCTTGTTTGCAAGCCAAGTTCTTCATTGACAGCCAATGCAATATGTTTGG
rJMSF010N14- CATCAATGAGTCTTGTTTGCAAGCCAAGCTCTTCATTGACAGCCAATGCAATATGTTTGG
rJMFF015L20- CATCAATGAGTCTTGTTTGCAAGCCAAGTTCTTCATTGACAGCCAATGCAATATGTTTGG
rJMSF041P06- CATCAATGAGTCTTGTTTGCAAGCCAAGTTCTTCATTGACAGCCAATGCAATATGTTTGG
rJMSF025J15- CATCAATGAGTCTTGTTTGCAAGCCAAGTTCTTCATTGACAGCCAATGCAATATGTTTGG
rJMSF028C18- CATCAATGAGTCTTGTTTGCAAGCCAAGTTCTTCATTGACAGCCAATGCAATATGTTTGG
rJMSF042P06- CATCAATGAGTCTTGTTTGCAAGCCAAGTTCTTCATTGACAGCCAATGCAATATGTTTGG
rJMSF009N14- CATCAATGAGTCTTGTTTGCAAGCCAAGCTCTTCATTGACAGCCAATGCAATATGTTTGG
JMSF028C18+ TTCATTGACAGCCAATGCAATATGTTTGG
JMSF041P06+ CATCAATGAGTCTTGTTTGCAAGCCAAGTTCTTCATTGACAGCCAATGCAATATGTTTGG
JMSF025J15+ AGCCAATGCAATATGTTTGG
                      ____________________________________________________________
consensus CATCAATGAGTCTTGTTTGCAAGCCAAGTTCTTCATTGACAGCCAATGCAATATGTTTGG
 
. : . : . : . : . : . :
JMFS084H07- TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTTGNC
rJMSF010N14- TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTTGTC
rJMFF015L20- TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTTGTC
rJMSF041P06- TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTTGTC
rJMSF025J15- TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTTGTC
rJMSF028C18- TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTTGTC
rJMSF042P06- TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTTGTC
rJMSF009N14- TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTTGTC
JMSF028C18+ TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTNGTC
JMFN003F24+ CTTTCATTATTTGTC
JMFN011J17+ TTCTTTCATTATTTGTC
JMSF041P06+ TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTTGTC
JMSF025J15+ TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTNGTC
                      ____________________________________________________________
consensus TGCTTATTACTGTCTCCTCCAATTTCTCGAGGCCTTCATCTTGTTCTTTCATTATTTGTC
 
. : . : . : . : . : . :
JMFS084H07- GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
rJMSF010N14- GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGTATCAACAG
rJMFF015L20- GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
rJMSF041P06- GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
rJMSF025J15- GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
rJMSF028C18- GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
rJMSF042P06- GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
rJMSF009N14- GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGTATCAACAG
JMSF028C18+ GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
JMFN003F24+ GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
JMFN011J17+ G-TGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
JMSF041P06+ GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
JMSF025J15+ GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
                      ____________________________________________________________
consensus GTTGAAGAGCGACAACGCCAGAATTGTCAAGGCCATTTGTTCTGCTCATGGCATCAACAG
 
. : . : . : . : . : . :
JMFS084H07- GCTTTAT
rJMSF010N14- GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
rJMFF015L20- GCTTTATTTCTGGTCCAAGTAAGATGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
rJMSF041P06- GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCANAGTCG
rJMSF025J15- GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
rJMSF028C18- GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
rJMSF042P06- GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
rJMSF009N14- GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
JMSF028C18+ GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
JMFN003F24+ GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
JMFN011J17+ GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
JMSF041P06+ GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
JMSF025J15+ GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
JMFF009P15+ TCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
JMFF015L20+ CTATTCGCAAAATTGGACATGTTCAAAGTCG
                      ____________________________________________________________
consensus GCTTTATTTCTGGTCCAAGTAAGCTGTCTCTATTCGCAAAATTGGACATGTTCAAAGTCG
 
. : . : . : . : . : . :
rJMSF010N14- ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
rJMFF015L20- ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
rJMSF041P06- ATGCCATCT
rJMSF025J15- ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
rJMSF028C18- ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
rJMSF042P06- ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCC
rJMSF009N14- ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
JMSF028C18+ ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
JMFN003F24+ ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
JMFN011J17+ ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
JMSF041P06+ ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
JMSF025J15+ ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
JMFF009P15+ ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
JMFF015L20+ ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
                      ____________________________________________________________
consensus ATGCCATCTGATTTGCTTTTGACCTTAAAGTTGCAAGCATGTCCTTGCGTCGATTAATCT
 
. : . : . : . : . : . :
rJMSF010N14- CTTTCTCAGTCAAAGGTTGCTTTGTAGNAAGTTTGGAC
rJMFF015L20- CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
rJMSF025J15- CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
rJMSF028C18- CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
rJMSF009N14- CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
JMSF028C18+ CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
JMFN003F24+ CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
JMFN011J17+ CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
JMSF041P06+ CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
JMSF025J15+ CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
JMFF009P15+ CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
JMSF009N14+ TCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
JMFF015L20+ CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
                      ____________________________________________________________
consensus CTTTCTCAGTCAAAGGTTGCTTTGTAGGAAGTTTGGACAAAAGAGACTCTAAGCTATCAA
 
. : . : . : . : . : . :
rJMFF015L20- GCCTAGTTCCC
rJMSF025J15- GCCTAGTTCCCAATATAGTAA-TTTTCCTCCTTATAGCANATGAATGACGCTGTGCCTCT
rJMSF028C18- GCCTAGTTCCCAATATAGTAATTTTTCCTCCTTATAGCAGATGAATGACGCTGTGCCTCT
rJMSF009N14- GCCTAGTTCCCAATATAGTAA-TTTTCCTCCTTATAGCANATGAATGACGCTGTGCCTCT
JMSF028C18+ GCCTAGTTCCCAATATAGTAATTTTTCCTCCTTATAGCAGATGAATGACGCTGTGCCTCT
JMFN003F24+ GCCTAGTTCCCAATATAGTAA-TTTTCCTCCTTATAGCAGATGAATGACGCTGTGCCTCT
JMFN011J17+ GCCTAGTTCCCAATATAGTAA-TTTTCCTCCTTATAGCAGATGAATGACGCTGTGCCTCT
JMSF041P06+ GCCTAGTTCCCAATATAGTAA-TTTTCCTCCTTATAGCAGATGAATGACGCTGTGCCTCT
JMSF025J15+ GCCTAGTTCCCAATATAGTAA-TTTTCCTCCTTATAGCAGATGAATGACGCTGTGCCTCT
JMFF009P15+ GCCTAGTTCCCAATNTAGTAA-TTTTCCTCCTTATAGCAGATGAATGACGCTGTGCCTCT
JMSF009N14+ GCCTAGTTCCCAATATAGTAA-TTTTCCTCCTTATAGCAGATGAATGACGCTGTGCCTCT
JMFF015L20+ GCCTAGTTCCCAATATAGTAA-TTTTCCTCCTTATAGCAGATGAATGACGCTGTGCCTCT
                      ____________________________________________________________
consensus GCCTAGTTCCCAATATAGTAA-TTTTCCTCCTTATAGCAGATGAATGACGCTGTGCCTCT
 
. : . : . : . : . : . :
rJMSF025J15- GTCC
rJMSF028C18- GTCCC
rJMSF009N14- GTCCCCTGTTGTGGGCAACG
JMSF028C18+ GT-CCCTGTTGTGGGCAACGAACTTCTTTCAGATATCATGTTAGTGATATCATCTGCAAG
JMFN003F24+ GT-CCCTGTTGTGGGCAACGAACTTCTTTCAGATATCATGTTAGTGATATCATCTGCAAG
JMFN011J17+ GT-CCCTGTTGTGGGCAACGAACTTCTTTCAGATATCATGTTAGTGATATCATCTGCAAG
JMSF041P06+ GT-CCCTGTTGTGGGCAACGAACTTCTTTCAGATATCATGTTAGTGATATCATCTGCAAG
JMSF025J15+ GT-CCCTGTTGTGGGCAACGAACTTCTTTCAGATATCATGTTAGTGATATCATCTGCAAG
JMFF009P15+ GT-CCCTGTTGTGGGCAACGAACTTCTTTCAGATATCATGTTAGTGATATCATCTGCAAG
JMSF009N14+ GT-CCCTGTTGTGGGCAACGAACTTCTTTCAGATATCATGTTAGTGATATCATCTGCAAG
JMFF015L20+ GT-CCCTGTTGTGGGCAACGAACTTCTTTCAGATATCATGTTAGTGATATCATCTGCAAG
                      ____________________________________________________________
consensus GT-CCCTGTTGTGGGCAACGAACTTCTTTCAGATATCATGTTAGTGATATCATCTGCAAG
 
. : . : . : . : . : . :
JMSF028C18+ CTTTACTGCTTCATTATACTCCCTGACCCATGAATCTCCAGAAGCTGCCATTG-------
JMFN003F24+ CTTTACTGCTTCATTATACTCCCTGACCCATGAATCTCCAGAAGCTGCCATTG-------
JMFN011J17+ CTTTACTGCTTCATTATACTCCCTGACCCATGAATCTCCAGAAGCTGCCATTG-------
JMSF041P06+ CTTTACTGCTTCATTATACTCCCTGACCCATGAATCTCCAGAAGCTGCCATTG-------
JMSF025J15+ CTTTACTGCTTCATTATACTCCCTGACCCATGAATCTCCAGAAGCTGCCATTG-------
JMFF009P15+ CTTTACTGCTTCATTATACTCCCTGACCCATGAATCTCCAGAAGCTGCCATTG-------
JMSF009N14+ CTTTACTGCTTCATTATACTCCCTGACCCATGAATCTCCAGAAGCTGCCATTGC
JMFF015L20+ CTTTACTGCTTCATTATACTCCCTGACCCATGAATCTCCAGAAGCTGCCATTGCCTTCAG
                      ____________________________________________________________
consensus CTTTACTGCTTCATTATACTCCCTGACCCATGAATCTCCAGAAGCTGCCATTG-------
 
. : . : . : . : . : . :
JMSF028C18+ -----CCTTTTGGATGGGAATAGGGGGCGGAAACGAAACTCAATTAGAAAGATGTGATAA
JMFN003F24+ -----CCTTTTGGATGGGAATAGGGGGCGGAAACGAAACTCAATTAGAAAGATGTGATAA
JMFN011J17+ -----CCTTTTGGATGGGAATAGGGGGCGGAAACGAAACTCAATTAGAAAGATGTGATAA
JMSF041P06+ -----CCTTTTGGATGGGAATAGGGGGCGGAAACGAAACTCAATTAGAAAGATGTGATAA
JMSF025J15+ -----CCTTTTGGATGGGAATAGGGGGCGGAAACGAAACTCAATTAGAAAGATGTGATAA
JMSF004N15+ GGATGGGAATAGGGGGCGGAAACGAAACTCAATTAGAAAGATGTGATAA
JMFF009P15+ -----CCTTTTGGATGGGAATAGGGGGCGGAAACGAAACTCAATTAGAAAGATGTGATAA
JMFF015L20+ CTAGTCCTTTTGGATGGGAATAGGGGGCGGAAACGAAACTCAACTAGAAAGATGTGATAA
                      ____________________________________________________________
consensus -----CCTTTTGGATGGGAATAGGGGGCGGAAACGAAACTCAATTAGAAAGATGTGATAA
 
. : . : . : . : . : . :
JMSF028C18+ TCGGGTGGGTATGATTGAGTTTTGACAAGCGGAGGAGAATCGGAAAGAGGCGACAGGAGG
JMFN003F24+ TCGGGTGGGTATGATTGAGTTTTGACAAGCGGAGGAGAATCGGAAAGAGGCGACAGGAGG
JMFN011J17+ TCGGGTGGGTATGATTGAGTTTTGACAAGCGGAGGAGAATCGGAAAGAGGCGACAGGAGG
JMSF041P06+ TCGGGTGGGTATGATTGAGTTTTGACAAGCGGAGGAGAATCGGAAAGAGGCGACAGGAGG
JMSF025J15+ TCGGGTGGGTATGATTGAGTTTTGACAAGCGGAGGAGAATCGGAAAGAGGCGACAGGAGG
JMSF004N15+ TCGGGTGGGTATGATTGAGTTTTGACAAGCGGAGGAGAATCGGAAAGAGGAGACAGGAGG
JMFF009P15+ TCGGGTGGGTATGATTGAGTTTTGACAAGCGGAGGAGAATCGGAAAGAGGCGACAGGAGG
JMFF015L20+ TCGGGTGGGTATGATTGAGTTTTGACAAGCGGAGGAGAATCGGAAAGAGGCGACAGGAGG
                      ____________________________________________________________
consensus TCGGGTGGGTATGATTGAGTTTTGACAAGCGGAGGAGAATCGGAAAGAGGCGACAGGAGG
 
. : . : . : . : . : . :
JMSF028C18+ AGACGCCACCACTTACCGGCAAGTTTTGTCGGACTTCGGCGTCGTCTTCGTGACGCGC
JMFN003F24+ AGACGCCACCACTTACCGGCAAGTTTTGTCGGGCTTCGGCGTCGTCTTCGTGACGCGCAT
JMFN011J17+ AGACGCCACCACTTACCGGCAAGTTTTGTCGGGCTTCGGCGTCGTCTTCGTGACGCGCAT
JMSF041P06+ AGACGCCACCACTTACCGGCAAGTTTTGTCGGGCTTCGGCGTCGTCTTCGTGACGCGCAT
JMSF025J15+ AGACGCCACCACTTACCGGCAAGTTTTGTCGGGCTTCGGCGTCGTCTTCGTGACGCGCAT
JMSF004N15+ AGACGCCACCACTTACCGGCAAGTTTTGTCGGGCTTCGGCGTCGTCTTCGTGACGCGCAT
JMFF009P15+ AGACGCCACCACTTACCGGCAAGTTTTGTCGGGCTTCGGCGTCGTCTTCGTGACGCGCAT
JMFF015L20+ AGACGCCACCACTTACCGGCAAGTTTTGTCGGGCTTCGGCGTCGTCTTCGTGACGCGCAT
                      ____________________________________________________________
consensus AGACGCCACCACTTACCGGCAAGTTTTGTCGGGCTTCGGCGTCGTCTTCGTGACGCGCAT
 
. : . : . : . : . : . :
JMFN003F24+ TCGGATTGAGATTGG
JMFN011J17+ TCGGATTGA
JMSF041P06+ TCGGATTGAGATTGGGAAAGAGCC
JMSF025J15+ TCGGATTGAGATTGGGAAAGAGCC
JMSF004N15+ TCGGATTGAGATTGGGAAAGAGCC
JMFF009P15+ TCGGATTGAGATTGGGAAAGAGCC
JMFF015L20+ TCGGATTGAGATTGGGAAAGAGCCTTTTGAGTTTGGACCGCTAAGGCGTATTATTCATTC
                      ____________________________________________________________
consensus TCGGATTGAGATTGGGAAAGAGCCTTTTGAGTTTGGACCGCTAAGGCGTATTATTCATTC