Previous Contig 000807:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015L09Sequence658000807 (2)gb:AF370499_17922844e-88Arabidopsis thaliana RNA lariat debranching enzyme - like protein (F28M20.40) mR740008933 (2)gb:AC135228_17421821e-22Oryza sativa chromosome 3 BAC OSJNBb0122C16 genomic sequence, complete sequence.
JMSF038F15Sequence679000807 (2)gb:AF370499_17922842e-93Arabidopsis thaliana RNA lariat debranching enzyme - like protein (F28M20.40) mR885008933 (2)gb:AF370499_17922845e-55Arabidopsis thaliana RNA lariat debranching enzyme - like protein (F28M20.40) mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038F15+ CTCGAAAAAAGGTTTTTGACGGAGAAGACTCTTCAAGT
                      ____________________________________________________________
consensus CTCGAAAAAAGGTTTTTGACGGAGAAGACTCTTCAAGT
 
. : . : . : . : . : . :
JMSF038F15+ TTCCGTGATCAGTAATGCCCACGGGCCAATCATGTGAAAGGAAGATATCAATTGGTTCTT
JMFF015L09+ CCGTGATCAGTAATGCCCACGGGCCAATCATGTGAAAGGAAGATATCAATTGGTTCTT
                      ____________________________________________________________
consensus TTCCGTGATCAGTAATGCCCACGGGCCAATCATGTGAAAGGAAGATATCAATTGGTTCTT
 
. : . : . : . : . : . :
JMSF038F15+ CAACTTGCATAAGCTTGTGAATATCATACTCACGAACATGATATATGGATCGTATATCTA
JMFF015L09+ CAACTTGCATAAGCTTGTGAATATCATACTCACGAACATGATATATGGATCGTATATCTA
                      ____________________________________________________________
consensus CAACTTGCATAAGCTTGTGAATATCATACTCACGAACATGATATATGGATCGTATATCTA
 
. : . : . : . : . : . :
JMSF038F15+ GCTCATTATAAGGAACCTTTTCATAATGTCCCGAATGATAGTGGTGTGATTTATATATTC
JMFF015L09+ GCTCATTATAAGGAACCTTTTCATAATGTCCCGAATGATAGTGGTGTGATTTATATATTC
                      ____________________________________________________________
consensus GCTCATTATAAGGAACCTTTTCATAATGTCCCGAATGATAGTGGTGTGATTTATATATTC
 
. : . : . : . : . : . :
JMSF038F15+ CAGAGAGGCCCCCAATACGAATGTTACCAAACTTGATTACTCCAGCAAATCCAAGGAAGT
JMFF015L09+ CAGAGAGGCCCCCAATACGAATGTTACCAAACTTGATTACTCCAGCAAATCCAAGGAAGT
                      ____________________________________________________________
consensus CAGAGAGGCCCCCAATACGAATGTTACCAAACTTGATTACTCCAGCAAATCCAAGGAAGT
 
. : . : . : . : . : . :
JMSF038F15+ ATATCTGAGGTGCTGCCCATCCTCCATAATATAGCTCCCACAGATAATTTGAGGCTTCAT
JMFF015L09+ ATATCTGAGGTGCTGCCCATCCTCCATAATATAGCTCCCACAGATAATTTGAGGCTTCAT
                      ____________________________________________________________
consensus ATATCTGAGGTGCTGCCCATCCTCCATAATATAGCTCCCACAGATAATTTGAGGCTTCAT
 
. : . : . : . : . : . :
JMSF038F15+ GATTGCCCCCTATGAAAATAGTTGGGAATGGTGCAACTTTTTCTCCTGAGTAATACTTCC
JMFF015L09+ GATTGCCCCCTATGAAAATAGTTGGGAATGGTGCAACTTTTTCTCCTGAGTAATACTTCC
                      ____________________________________________________________
consensus GATTGCCCCCTATGAAAATAGTTGGGAATGGTGCAACTTTTTCTCCTGAGTAATACTTCC
 
. : . : . : . : . : . :
JMSF038F15+ AGAAAGAGTTCATGCTCTTGTACTTGGGTGGCACATTTAAACTTTCAAGATCCTTCTCAT
JMFF015L09+ AGAAAGAGTTCATGCTCTTGTACTTGGGTGGCACATTTAAACTTTCAAGATCCTTCTCAT
                      ____________________________________________________________
consensus AGAAAGAGTTCATGCTCTTGTACTTGGGTGGCACATTTAAACTTTCAAGATCCTTCTCAT
 
. : . : . : . : . : . :
JMSF038F15+ TCCTAACAGCCTGAAAGTCACCACAGCATATCAAAAGATCAATCTTTATTTTCTCCACAT
JMFF015L09+ TCCTAACAGCCTGAAAGTCACCACAGCATATCAAAAGATCAATCTTTATTTTCTCCACAT
                      ____________________________________________________________
consensus TCCTAACAGCCTGAAAGTCACCACAGCATATCAAAAGATCAATCTTTATTTTCTCCACAT
 
. : . : . : . : . : . :
JMSF038F15+ CCTGTAAGTGTAATAAGGTAGCATACACATTGTCTAGGTCTCCATGCATACACCCTTCTA
JMFF015L09+ CCTGTAAGTGTAATAAGGTAGCATACACATTGTCTAGGTCTCCATGCATACACCCTTCTA
                      ____________________________________________________________
consensus CCTGTAAGTGTAATAAGGTAGCATACACATTGTCTAGGTCTCCATGCATACACCCTTCTA
 
. : . : . : . : . : . :
JMSF038F15+ CTGCTATCTTCATCTCTAAATATGACAGTTGTAGAACTTCTCTATGATCTCAAGGTAAGC
JMFF015L09+ CTGCTATCTTCATCTCTAAATATGACAGTTGTAGAACTTCTCTATGATCTCAAGGTAAGC
                      ____________________________________________________________
consensus CTGCTATCTTCATCTCTAAATATGACAGTTGTAGAACTTCTCTATGATCTCAAGGTAAGC
 
. : . : . : . : . : . :
JMSF038F15+ GGGGACGCTATCCACGGCAACTTAGAAGCTTGGAGGCAGT
JMFF015L09+ GGGGACGCTATCCACGGCAACTTAGAAGCTTGGAGGCAGTGGGGCTGTGAAGTTGTTCCT
                      ____________________________________________________________
consensus GGGGACGCTATCCACGGCAACTTAGAAGCTTGGAGGCAGTGGGGCTGTGAAGTTGTTCCT