Previous Contig 000804:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015L03Sequence570000804 (2)sp|Q9SJA7|SOX_ARATH1e-37Potential sarcosine oxidase (EC 1.5.3.1).>pir|D84638|D84638 probable sarcosine o720010899 (2)sp|Q9SJA7|SOX_ARATH4e-71Potential sarcosine oxidase (EC 1.5.3.1).>pir|D84638|D84638 probable sarcosine o
JMFF049F13Sequence639000804 (2)sp|Q9SJA7|SOX_ARATH3e-42Potential sarcosine oxidase (EC 1.5.3.1).>pir|D84638|D84638 probable sarcosine o620010899 (2)sp|Q9SJA7|SOX_ARATH1e-58Potential sarcosine oxidase (EC 1.5.3.1).>pir|D84638|D84638 probable sarcosine o

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049F13+ CGGTAACTGAAAACGGCCCCCAAACTCCTCCGAAACCCGT
                      ____________________________________________________________
consensus CGGTAACTGAAAACGGCCCCCAAACTCCTCCGAAACCCGT
 
. : . : . : . : . : . :
JMFF049F13+ GTCGGATCCAAAACCCGAACCGGAATGGAAACTTTCCGGCAGCTTGAAACGACGGCTTGC
JMFF015L03+ ACTTTCCGGCAGCTTGAAACGACGGCTTGC
                      ____________________________________________________________
consensus GTCGGATCCAAAACCCGAACCGGAATGGAAACTTTCCGGCAGCTTGAAACGACGGCTTGC
 
. : . : . : . : . : . :
JMFF049F13+ AAAGCCGTGTTGTCCGCCGGTCCCATGTCTAACTGCCGGGTCTTGAAGAAGACCTNGTAG
JMFF015L03+ AAAGCCGTGTTGTCCGCCGGTCCCATGTCTAACTGCCGGGTCTTGAAGAAGACCTTGTAG
                      ____________________________________________________________
consensus AAAGCCGTGTTGTCCGCCGGTCCCATGTCTAACTGCCGGGTCTTGAAGAAGACCTTGTAG
 
. : . : . : . : . : . :
JMFF049F13+ CCAATCTCGGCTTCGGCTTCGCGCCACAGAGTCTCGGCGGCCAAGACCATCTTGGCATAA
JMFF015L03+ CCAATCTCGGCTTCGGCTTCGCGCCACAGAGTCTCGGCGGCCAAGACCATCTTGGCATAA
                      ____________________________________________________________
consensus CCAATCTCGGCTTCGGCTTCGCGCCACAGAGTCTCGGCGGCCAAGACCATCTTGGCATAA
 
. : . : . : . : . : . :
JMFF049F13+ TATTCCTCCGGGTAGGTTGCCCGGATAGTTCTGGACTCGCCATGGGAGGAGCCGCGGTGG
JMFF015L03+ TATTCCTCCGGGTAGGTTGCCCGGATAGTTCTGGACTCGCCATGGGAGGAGCCGCGGTGG
                      ____________________________________________________________
consensus TATTCCTCCGGGTAGGTTGCCCGGATAGTTCTGGACTCGCCATGGGAGGAGCCGCGGTGG
 
. : . : . : . : . : . :
JMFF049F13+ TGCAAGAAATCGAATTGCTCGAGAAGGAGGGTCCTTAGGCCGCGTTTGGCTGACTGATAA
JMFF015L03+ TGCAAGAAATCGAATTGCTCGAGAAGGAGGGTCCTTAGGCCGCGTTTGGCTGACTGATAA
                      ____________________________________________________________
consensus TGCAAGAAATCGAATTGCTCGAGAAGGAGGGTCCTTAGGCCGCGTTTGGCTGACTGATAA
 
. : . : . : . : . : . :
JMFF049F13+ GCTGCGCAGCTGCCCATTATTCCTCCCCCCACAACTATCACATCAAATTCGATTTTTTCC
JMFF015L03+ GCTGCGCAGCTGCCCATTATTCCTCCCCCCACAACTATCACATCAAATTCGATTTTTTCC
                      ____________________________________________________________
consensus GCTGCGCAGCTGCCCATTATTCCTCCCCCCACAACTATCACATCAAATTCGATTTTTTCC
 
. : . : . : . : . : . :
JMFF049F13+ ATCTCTGATCTTCAGATAAGAATTAGATGGATATGAATGTATATATAGAATCTCAGCCGA
JMFF015L03+ ATCTCTGATCTTCAGATAAGAATTAGATGGATATGAATGTATATATAGAATCTCAGCCGA
                      ____________________________________________________________
consensus ATCTCTGATCTTCAGATAAGAATTAGATGGATATGAATGTATATATAGAATCTCAGCCGA
 
. : . : . : . : . : . :
JMFF049F13+ TAAAATTGAATCTAGCAGAGAGTTTCGGGTCAGAGCTGAGGTTGCTATGAAAAGTTGAAA
JMFF015L03+ TAAAATTGAATCTAGCAGAGAGTTTCGGGTCAGAGCTGAGGTTGCTATGAAAAGTTGAAA
                      ____________________________________________________________
consensus TAAAATTGAATCTAGCAGAGAGTTTCGGGTCAGAGCTGAGGTTGCTATGAAAAGTTGAAA
 
. : . : . : . : . : . :
JMFF049F13+ AATATTGTTCTCAGACTATCGAGGAAGGGTTTGACAAGATGGAATCTACCAATTTGTAAG
JMFF015L03+ AATATTGTTCTCAGACTATCGAGGAAGGGTTTGACAAGATGGAATCTACCAATTTGTAAG
                      ____________________________________________________________
consensus AATATTGTTCTCAGACTATCGAGGAAGGGTTTGACAAGATGGAATCTACCAATTTGTAAG
 
. : . : . : . : . : . :
JMFF049F13+ CTTGAATATTACATTATATTGCAGAAGAAACTGGG-TTGAGAAGAAAGTAACAGAGACTC
JMFF015L03+ CTTGAATATTACATTATATTGCAGAAGAAACTGGGTTTGAGAAGAAAGTAACAGAGACTC
                      ____________________________________________________________
consensus CTTGAATATTACATTATATTGCAGAAGAAACTGGGTTTGAGAAGAAAGTAACAGAGACTC