Previous Contig 000803:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011J14Sequence560000803 (11)pir|E86162|E861626e-34hypothetical protein F10O3.3 - Arabidopsis thaliana>gb:AE005172_889334 Arabidops681000803 (11)gb:AP005908_18599152e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMFF015K12Sequence569000803 (11)pir|E86162|E861623e-31hypothetical protein F10O3.3 - Arabidopsis thaliana>gb:AE005172_889334 Arabidops549000803 (11)gb:AP005908_18599156e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMFF038F17Sequence589000803 (11)pir|E86162|E861626e-34hypothetical protein F10O3.3 - Arabidopsis thaliana>gb:AE005172_889334 Arabidops770000803 (11)gb:AP005908_18599154e-90Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMFS106F04Sequence627000803 (11)pir|E86162|E861626e-41hypothetical protein F10O3.3 - Arabidopsis thaliana>gb:AE005172_889334 Arabidops
JMSF022C23Sequence678000803 (11)pir|E86162|E861623e-40hypothetical protein F10O3.3 - Arabidopsis thaliana>gb:AE005172_889334 Arabidops803000803 (11)gb:AP005908_18599157e-82Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMSF029D01Sequence625000803 (11)pir|E86162|E861623e-40hypothetical protein F10O3.3 - Arabidopsis thaliana>gb:AE005172_889334 Arabidops732000803 (11)gb:AP005908_18599156e-82Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022C23- TAAATGTGTAAAG
                      ____________________________________________________________
consensus TAAATGTGTAAAG
 
. : . : . : . : . : . :
rJMFF011J14- CTTCTGGTC-TCTAATTTTAGTAAAGGAGAGAACA
rJMSF022C23- ACAACGAAGGATTCTGGTCATTTAACTTCTGGTCATCTAATTTTAGTAAAGGAGAGAACA
                      ____________________________________________________________
consensus ACAACGAAGGATTCTGGTCATTTAACTTCTGGTCATCTAATTTTAGTAAAGGAGAGAACA
 
. : . : . : . : . : . :
rJMFF015K12- GTTAATTACAGACAAAGCAGAATGTTCAGTAGTTGTTTAGTA
rJMFF011J14- ATTCAGGATTAAACCAACGTTAATTACAGACAAAGCAGAATGTTCAGTAGTTGTTTAGTA
rJMSF022C23- ATTCAGGATTAAACCAACGTTAATTACAGACAAAGCAGAATGTTCAGTAGTTGTTTAGTA
rJMSF029D01- CAGACAAAGCAGAATGTTCAGTAGTTGTTTAGTA
rJMFF038F17- GTTAATTACAGACAAAGCAGAATGTTCAGTAGTTGTTTAGTA
                      ____________________________________________________________
consensus ATTCAGGATTAAACCAACGTTAATTACAGACAAAGCAGAATGTTCAGTAGTTGTTTAGTA
 
. : . : . : . : . : . :
rJMFF015K12- GTATACAACAAAATGACTGCTACGTTGTAGAGAAGATGATGTGTATCCTTTAGGCAGGCA
rJMFF011J14- GTATACAACAAAATGACTGCTACGTTGTAGAGAAGATGATGTGTATCCTTTAGGCAGGCA
rJMSF022C23- GTATACAACAAAATGACTGCTACGTTGTAGAGAAGATGATGTGTATCCTTTAGGCAGGCA
rJMSF029D01- GTATACAACAAAATGACTGCTACGTTGTAGAGAAGATGATGTGTATCCTTTAGGCAGGCA
rJMFF038F17- GTATACAACAAAATGACTGCTACGTTGTAGAGAAGATGATGTGTATCCTTTAGGCAGGCA
                      ____________________________________________________________
consensus GTATACAACAAAATGACTGCTACGTTGTAGAGAAGATGATGTGTATCCTTTAGGCAGGCA
 
. : . : . : . : . : . :
rJMFF015K12- ATATGCGAAGCTTTTCCTCCGAGGATTGAGATCCCCCTGAAGACTTTTCTTCTGCAAGAA
rJMFF011J14- ATATGCGAAGCTTTTCCTCCGAGGATTGAGATCCCCCTGAAGACTTTTCTTCTGCAAGAA
rJMSF022C23- ATATGCGAAGCTTTTCCTCCGAGGATTGAGATCCCCCTGAAGACTTTTCTTCTGCAAGAA
rJMSF029D01- ATATGCGAAGCTTTTCCTCCGAGGATTGAGATCCCCCTGAAGACTTTTCTTCTGCAAGAA
rJMFF038F17- ATATGCGAAGCTTTTCCTCCGAGGATTGAGATCCCCCTGAAGACTTTTCTTCTGCAAGAA
                      ____________________________________________________________
consensus ATATGCGAAGCTTTTCCTCCGAGGATTGAGATCCCCCTGAAGACTTTTCTTCTGCAAGAA
 
. : . : . : . : . : . :
rJMFF015K12- GTGACTGCAAATCGCTGCCATTGGCGAGGCTGTTGAACTCCACGGCCTTCGATGGGGCAG
rJMFF011J14- GTGACTGCAAATCGCTGCCATTGGCGAGGCTGTTGAACTCCACGGCCTTCGATGGGGCAG
rJMSF022C23- GTGACTGCAAATCGCTGCCATTGGCGAGGCTGTTGAACTCCACGGCCTTCGATGGGGCAG
rJMSF029D01- GTGACTGCAAATCGCTGCCATTGGCGAGGCTGTTGAACTCCACGGCCTTCGATGGGGCAG
rJMFF038F17- GTGACTGCAAATCGCTGCCATTGGCGAGGCTGTTGAACTCCACGGCCTTCGATGGGGCAG
                      ____________________________________________________________
consensus GTGACTGCAAATCGCTGCCATTGGCGAGGCTGTTGAACTCCACGGCCTTCGATGGGGCAG
 
. : . : . : . : . : . :
rJMFF015K12- TGGGGTAGCGGCGTTGACAGAATGTCATCAATCGCTTGACTGACTGCAAATACTTCCGGG
rJMFF011J14- TGGGGTAGCGGCGTTGACAGAATGTCATCAATCGCTTGACTGACTGCAAATACTTCCGGG
rJMSF022C23- TGGGGTAGCGGCGTTGACAGAATGTCATCAATCGCTTGACTGACTGCAAATACTTCCGGG
rJMSF029D01- TGGGGTAGCGGCGTTGACAGAATGTCATCAATCGCTTGACTGACTGCAAATACTTCCGGG
rJMFF038F17- TGGGGTAGCGGCGTTGACAGAATGTCATCAATCGCTTGACTGACTGCAAATACTTCCGGG
                      ____________________________________________________________
consensus TGGGGTAGCGGCGTTGACAGAATGTCATCAATCGCTTGACTGACTGCAAATACTTCCGGG
 
. : . : . : . : . : . :
rJMFF015K12- TAGTCTCGTCATTCATGATGTGTGCAACGCTGTTGGTGTAGATCTTCTCACGGGCTGAAC
rJMFF011J14- TAGTCTCGTCATTCATGATGTGTGCAACGCTGTTGGTGTAGATCTTCTCACGGGCTGAAC
rJMSF022C23- TAGTCTCGTCATTCATGATGTGTGCAACGCTGTTGGTGTAGATCTTCTCACGGGCTGAAC
rJMSF029D01- TAGTCTCGTCATTCATGATGTGTGCAACGCTGTTGGTGTAGATCTTCTCACGGGCTGAAC
rJMFF038F17- TAGTCTCGTCATTCATGATGTGTGCAACGCTGTTGGTGTAGATCTTCTCACGGGCTGAAC
                      ____________________________________________________________
consensus TAGTCTCGTCATTCATGATGTGTGCAACGCTGTTGGTGTAGATCTTCTCACGGGCTGAAC
 
. : . : . : . : . : . :
rJMFF015K12- GTTCGTGGATACCAACCATAGTAACACCAATAGGCCAAGGGGCATTACCAATGGCGAGTT
rJMFF011J14- GTTCGTGGATACCAACCATAGTAACACCAATAGGCCAAGGGGCATTACCAATGGCGAGTT
rJMSF022C23- GTTCGTGGATACCAACCATAGTAACACCAATAGGCCAAGGGGCATTACCAATGGCGAGTT
rJMSF029D01- GTTCGTGGATACCAACCATAGTAACACCAATAGGCCAAGGGGCATTACCAATGGCGAGTT
rJMFF038F17- GTTCGTGGATACCAACCATAGTAACACCAATAGGCCAAGGGGCATTACCAATGGCGAGTT
                      ____________________________________________________________
consensus GTTCGTGGATACCAACCATAGTAACACCAATAGGCCAAGGGGCATTACCAATGGCGAGTT
 
. : . : . : . : . : . :
rJMFF015K12- TGATGTAGTGATCCATGGCGGCTAGATAATCTCGCTCTATGCAGCACTGAACCATCAAAA
rJMFF011J14- TGATGTAGTGATCCATGGCGGCTAGATAATCTCGCTCTATGCAGCACTGAACCATCAAAA
rJMSF022C23- TGATGTAGTGATCCATGGCGGCTAGATAATCTCGCTCTATGCAGCACTGAACCATCAAAA
rJMSF029D01- TGATGTAGTGATCCATGGCGGCTAGATAATCTCGCTCTATGCAGCACTGAACCATCAAAA
rJMFF038F17- TGATGTAGTGATCCATGGCGGCTAGATAATCTCGCTCTATGCAGCACTGAACCATCAAAA
                      ____________________________________________________________
consensus TGATGTAGTGATCCATGGCGGCTAGATAATCTCGCTCTATGCAGCACTGAACCATCAAAA
 
. : . : . : . : . : . :
rJMFF015K12- GTAACGCTTGCCGAATATCATCAGGCAGTACCTTCTTCCTGCAGAACTTGAATAGAGGAT
rJMFF011J14- GTAACGCTTGCCGAATATCATCAGGCAGTACCTTCTTCCTGCAGAACTTGAATAGAGGAT
rJMSF022C23- GTAACGCTTGCCGAATATCATCAGGCAGTACCTTCTTCCTGCAGAACTTGAATAGAGGAT
rJMSF029D01- GTAACGCTTGCCGAATATCATCAGGCAGTACCTTCTTCCTGCAGAACTTGAATAGAGGAT
rJMFF038F17- GTAACGCTTGCCGAATATCATCAGGCAGTACCTTCTTCCTGCAGAACTTGAATAGAGGAT
                      ____________________________________________________________
consensus GTAACGCTTGCCGAATATCATCAGGCAGTACCTTCTTCCTGCAGAACTTGAATAGAGGAT
 
. : . : . : . : . : . :
rJMFF015K12- TCAAGTACCTTGCACACTGCTTGAATG
rJMFF011J14- TCAAGTACCTTGCACACTGCTTGAATGTGGCAACCATAGATTTCCCCTTGGCCGTCCTCT
rJMSF022C23- TCAAGTACCTTGCACACTGCTTGAATGTGGCAACCATAGATTTCCCCTTGGCCGTCCTCT
rJMSF029D01- TCAAGTACCTTGCACACTGCTTGAATGTGGCAACCATAGATTTCCCCTTGGCCGTCCTCT
rJMFF038F17- TCAAGTACCTTGCACACTGCTTGAATGTGGCAACCATAGATTTCCCCTTGGCCGTCCTCT
                      ____________________________________________________________
consensus TCAAGTACCTTGCACACTGCTTGAATGTGGCAACCATAGATTTCCCCTTGGCCGTCCTCT
 
. : . : . : . : . : . :
rJMFF011J14- TTTCAGTCTCGGTCATCTCATCAAGCTCTTGGTTCCACTCATTCAGT
rJMSF022C23- TTTCAGTCTCGGTCATCTCATCAAGCTCTTGGTTCCACTCATTCAGTAACCTCTTAAAGA
rJMSF029D01- TTTCAGTCTCGGTCATCTCATCAAGCTCTTGGTTCCACTCATTCAGTAACCTCTTAAAGA
rJMFF038F17- TTTCAGTCTCGGTCATCTCATCAAGCTCTTGGTTCCACTCATTCAGTAACCTCTTAAAGA
                      ____________________________________________________________
consensus TTTCAGTCTCGGTCATCTCATCAAGCTCTTGGTTCCACTCATTCAGTAACCTCTTAAAGA
 
. : . : . : . : . : . :
rJMSF022C23- ATACCAGAATCTTATCCTCATCACAAAGCTCCTC-AAATTCGTCTTCATCCTCTTCAANT
rJMSF029D01- ATACCAGAATCTTATCCTCATCACAAAGCTCCTC-AAATTCGTCTTCATCCTCTTCAAAT
rJMFF038F17- ATACCAGAATCTTATCCTCATCACAAAGCTCCTCAAAATTCGTCTTCATCCTCTTCAAAT
                      ____________________________________________________________
consensus ATACCAGAATCTTATCCTCATCACAAAGCTCCTC-AAATTCGTCTTCATCCTCTTCAAAT
 
. : . : . : . : . : . :
rJMSF022C23- CCTTATCGTAA
rJMSF029D01- CCTTATCGTAATCCACTCCTGACGA
rJMFF038F17- CCTTATCGTAATCCACTCCTGACGAGCCCCCGTCTCCACTCAAATCATCATCACCGCCTC
JMFS106F04+ AAATCATCATCACCGCCTC
JMSF022C23+ CCACTCCTGACGAGCCCCCGTCTCCACTCAAATCATCATCACCGCCTC
                      ____________________________________________________________
consensus CCTTATCGTAATCCACTCCTGACGAGCCCCCGTCTCCACTCAAATCATCATCACCGCCTC
 
. : . : . : . : . : . :
rJMFF038F17- CTCCC
JMFS106F04+ CTCCCTCTTTATCCTCAGCATCCTCCCTGGCCTTCCGTTTCCTTTCACTCAAAATCCCCG
JMSF022C23+ CTCCCTCTTTATCCTCAGCATCCTCCCTGGCCTTCCGTTTCCTTTCACTCAAAATCCCCG
JMSF029D01+ GCCTTCCGTTTCCTTTCACTCAAAATCCCCG
                      ____________________________________________________________
consensus CTCCCTCTTTATCCTCAGCATCCTCCCTGGCCTTCCGTTTCCTTTCACTCAAAATCCCCG
 
. : . : . : . : . : . :
JMFS106F04+ ACTTCTGTCGTTTCTTCAACTCCACAATATCACGCAGGAAATCATTCGTTTGCCCCTCCG
JMSF022C23+ ACTTCTGTCGTTTCTTCAACTCCACAATATCACGCAGGAAATCATTCGTTTGCCCCTCCG
JMSF029D01+ ACTTCTGTCGTTTCTTCAACTCCACAATATCACGCAGGAAATCATTCGTTTGCCCCTCCG
JMFF011J14+ CTTCAACTCCACAATATCACGCAGGAAATCATTCGTTTGCCCCTCCG
JMFF038F17+ TTCTTCAACTCCACAATATCACGCAGGAAATCATTCGTTTGCCCCTCCG
JMFF015K12+ ACGCAGGAAATCATTCGTTTGCCCCTCCG
                      ____________________________________________________________
consensus ACTTCTGTCGTTTCTTCAACTCCACAATATCACGCAGGAAATCATTCGTTTGCCCCTCCG
 
. : . : . : . : . : . :
JMFS106F04+ TCATATCGCTATCGTCGACTTCAAAAAGCCCCGCTTTCAACACATACTTCAATCTATCAA
JMSF022C23+ TCATATCGCTATCGTCGACTTCAAAAAGCCCCGCTTTCAACACATACTTCAATCTATCAA
JMSF029D01+ TCATATCGCTATCGTCGACTTCAAAAAGCCCCGCTTTCAACACATACTTCAATCTATCAA
JMFF011J14+ TCATATCGCTATCGTCGACTTCAAAAAGCCCCGCTTTCAACACATACTTCAATCTATCAA
JMFF038F17+ TCATATCGCTATCGTCGACTTCAAAAAGCCCCGCTTTCAACACATACTTCAATCTATCAA
JMFF015K12+ TCATATCGCTATCGTCGACTTCAAAAAGCCCCGCTTTCAACACATACTTCAATCTATCAA
                      ____________________________________________________________
consensus TCATATCGCTATCGTCGACTTCAAAAAGCCCCGCTTTCAACACATACTTCAATCTATCAA
 
. : . : . : . : . : . :
JMFS106F04+ GCCTCGCCTCATCGTCTTCGCCGAAAAGAGTGACAGGCTGTTTAAGGAAGCGGAGTCGGC
JMSF022C23+ GCCTCGCCTCATCGTCTTCGCCGAAAAGAGTGACAGGCTGTTTAAGGAAGCGGAGTCGGC
JMSF029D01+ GCCTCGCCTCATCGTCTTCGCCGAAAAGAGTGACAGGCTGTTTAAGGAAGCGGAGTCGGC
JMFF011J14+ GCCTCGCCTCATCGTCTTCGCCGAAAAGAGTGACAGGCTGTTTAAGGAAGCGGAGTCGGC
JMFF038F17+ GCCTCGCCTCATCGTCTTCGCCGAAAAGAGTGACAGGCTGTTTAAGGAAGCGGAGTCGGC
JMFF015K12+ GCCTCGCCTCATCGTCTTCGCCGAAAAGAGTGACAGGCTGTTTAAGGAAGCGGAGTCGGC
                      ____________________________________________________________
consensus GCCTCGCCTCATCGTCTTCGCCGAAAAGAGTGACAGGCTGTTTAAGGAAGCGGAGTCGGC
 
. : . : . : . : . : . :
JMFS106F04+ GAATAACTTCCTGCCTCGAAAGATTGAGCGAGTCGATCTTCTGTTCGTCCGTTAGGGTTT
JMSF022C23+ GAATAACTTCCTGCCTCGAAAGATTGAGCGAGTCGATCTTCTGTTCGTCCGTTAGGGTTT
JMSF029D01+ GAATAACTTCCTGCCTCGAAAGATTGAGCGAGTCGATCTTCTGTTCGTCCGTTAGGGTTT
JMFF011J14+ GAATAACTTCCTGCCTCGAAAGATTGAGCGAGTCGATCTTCTGTTCGTCCGTTAGGGTTT
JMFF038F17+ GAATAACTTCCTGCCTCGAAAGATTGAGCGAGTCGATCTTCTGTTCGTCCGTTAGGGTTT
JMFF015K12+ GAATAACTTCCTGCCTCGAAAGATTGAGCGAGTCGATCTTCTGTTCGTCCGTTAGGGTTT
                      ____________________________________________________________
consensus GAATAACTTCCTGCCTCGAAAGATTGAGCGAGTCGATCTTCTGTTCGTCCGTTAGGGTTT
 
. : . : . : . : . : . :
JMFS106F04+ GGGGTTTGGAAGACGAGGCGTTGAATTCGGCGTTGGATTTGCTGAGATTATCGGAGTTGG
JMSF022C23+ GGGGTTTGGAAGACGAGGCGTTGAATTCGGCGTTGGATTTGCTGAGATTATCGGAGTTGG
JMSF029D01+ GGGGTTTGGAAGACGAGGCGTTGAATTCGGCGTTGGATTTGCTGAGATTATCGGAGTTGG
JMFF011J14+ GGGGTTTGGAAGACGAGGCGTTGAACTCGGCGTTGGATTTGCTGAGATTATCGGAGTTGG
JMFF038F17+ GGGGTTTGGAAGACGAGGCGTTGAATTCGGCGTTGGATTTGCTGAGATTATCGGAGTTGG
JMFF015K12+ GGGGTTTGGAAGACGAGGCGTTGAATTCGGCGTTGGATTTGCTGAGATTATCGGAGTTGG
                      ____________________________________________________________
consensus GGGGTTTGGAAGACGAGGCGTTGAATTCGGCGTTGGATTTGCTGAGATTATCGGAGTTGG
 
. : . : . : . : . : . :
JMFS106F04+ AGTTAGGATTGGAAGAGGAGTCGGCGCCGGAGTTGTTTTTCTGTTCCGATTGCTTCTTAC
JMSF022C23+ AGTTAGGATTGGAAGAGGAGTCGGCGCCGGAGTTGTTTTTCTGTTCCGATTGCTTCTTAC
JMSF029D01+ AGTTAGGATTGGAAGAGGAGTCGGCGCCGGAGTTGTTTTTCTGTTCCGATTGCTTCTTAC
JMFF011J14+ AGTTAGGATTGGAAGAGGAGTCGGCGCCGGAGTTGTTTTTCTGTTCCGATTGCTTCTTAC
JMFF038F17+ AGTTAGGATTGGAAGAGGAGTCGGCGCCGGAGTTGTTTTTCTGTTCCGATTGCTTCTTAC
JMFF015K12+ AGTTAGGATTGGAAGAGGAGTCGGCGCCGGAGTTGTTTTTCTGTTCCGATTGCTTCTTAC
                      ____________________________________________________________
consensus AGTTAGGATTGGAAGAGGAGTCGGCGCCGGAGTTGTTTTTCTGTTCCGATTGCTTCTTAC
 
. : . : . : . : . : . :
JMFS106F04+ GGAGCGCTTTGGCTTCGGCTTCGCGTTTCTCCTCCTCGTGAAGCCGCTGAAGGCGTTTCT
JMSF022C23+ GGAGCGCTTTGGCTTCGGCTTCGCGTTTCTCCTCCTCGTGAAGCCGCTGAAGGCGTTTCT
JMSF029D01+ GGAGCGCTTTGGCTTCGGCTTCGCGTTTCTCCTCCTCGTGAAGCCGCTGAAGGCGTTTCT
JMFF011J14+ GGAGCGCTTTGGCTTCGGCTTCGCGTTTCTCCTCCTCGTGAAGCCGCTGAAGGCGTTTCT
JMFF038F17+ GGAGCGCTTTGGCTTCGGCTTCGCGTTTCTCCTCCTCGTGAAGCCGCTGAAGGCGTTTCT
JMFF015K12+ GGAGCGCTTTGGCTTCGGCTTCGCGTTTCTCCTCCTCGTGAAGCCGCTGAAGGCGTTTCT
                      ____________________________________________________________
consensus GGAGCGCTTTGGCTTCGGCTTCGCGTTTCTCCTCCTCGTGAAGCCGCTGAAGGCGTTTCT
 
. : . : . : . : . : . :
JMFS106F04+ GCTCGATCTCGGAGCGTTTGAAGACCCGCTTGCCTCCGACGTCTTCTCTTAGGCTGTTCC
JMSF022C23+ GCTCGATCTCGGAGCGTTTGAAGACCCGCTTGCCTCCGACGTCTTCTCTTAGGCTGTTCC
JMSF029D01+ GCTCGATCTCGGAGCGTTTGAAGACCCGCTTGCCTCCGACGTCTTCTCTTAGGCTGTTCC
JMFF011J14+ GCTCGATCTCGGAGCGTTTGAAGACCCGCTTGCCTCCGACGTCTTCTCTTAGGCTGTTCC
JMFF038F17+ GCTCGATCTCGGAGCGTTTGAAGACCCGCTTGCCTCCGACGTCTTCTCTTAGGCTGTTCC
JMFF015K12+ GCTCGATCTCGGAGCGTTTGAAGACCCGCTTGCCTCCGACGTCTTCTCTTAGGCTGTTCC
                      ____________________________________________________________
consensus GCTCGATCTCGGAGCGTTTGAAGACCCGCTTGCCTCCGACGTCTTCTCTTAGGCTGTTCC
 
. : . : . : . : . : . :
JMFS106F04+ GCCTCTTTTCCAGCTCCTGTTTGAGAATATCCATGATTAGGGTTTCTCTCTCCGGTGCCG
JMSF022C23+ GCCTCTATTCCAGCTCCTGTTTGAGAATATCCATGATTAGGGTTTCTCTCTCCGGTGCCG
JMSF029D01+ GCCTCTTTTCCAGCTCCTGTTTGAGAATATCCATGATTAGGGTTTCTCTCTCCGGTGCCG
JMFF011J14+ GCCTCTTTTCCAGCTCCTGTTTGAGAATATCCATGATTAGGGTTTCTCTCTCCGGTGCCG
JMFF038F17+ GCCTCTTTTCCAGCTCCTGTTTGAGAATATCCATGATTAGGGTTTCTCTCTCCGGTGCCG
JMFF015K12+ GCCTCTTTTCCAGCTCCTGTTTGAGAATATCCATGATTAGGGTTTCTCTCTCCGGTGCCG
                      ____________________________________________________________
consensus GCCTCTTTTCCAGCTCCTGTTTGAGAATATCCATGATTAGGGTTTCTCTCTCCGGTGCCG
 
. : . : . : . : . : . :
JMFS106F04+ ACGAAAAG
JMSF022C23+ ACGAAAAGCCCAAACTTCAATCGAAACTC
JMSF029D01+ ACGAAAAGCCCAAACTTCAATCGAAACTCAGACAAAAGATCAGAGAAGATACT
JMFF011J14+ ACGAAAAGCCCAAACTTCAATCGAAACTCAGAC
JMFF038F17+ ACGAAAAGCCCAAACTTCAATCGAAACTCAGACAAAAGATCAGAGAAGATACT
JMFF015K12+ ACGAAAAGCCCAAACTTCAATCGAAACTCAGACAAAAGATCAGAGAAGATACTGTAGTGT
                      ____________________________________________________________
consensus ACGAAAAGCCCAAACTTCAATCGAAACTCAGACAAAAGATCAGAGAAGATACTGTAGTGT