Previous Contig 000798:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015I22Sequence569000798 (6)pir|H96777|H967776e-26hypothetical protein F9E10.31 [imported] - Arabidopsis thaliana>gb:AE005173_8950222008928 (3)
JMFF031O05Sequence635000798 (6)gb:AY196776_15889371e-43Malus xiaojinensis transcription factor Myb1 mRNA, complete cds.357008928 (3)gb:U97553_24570562e-05Murine herpesvirus 68 strain WUMS, complete genome.
JMFS119C04Sequence627000798 (6)gb:AY196776_15889372e-43Malus xiaojinensis transcription factor Myb1 mRNA, complete cds.
JMFS140D11Sequence613000798 (6)gb:AY196776_15889371e-43Malus xiaojinensis transcription factor Myb1 mRNA, complete cds.
JMSF005H02Sequence388000798 (6)pir|H96777|H967777e-21hypothetical protein F9E10.31 [imported] - Arabidopsis thaliana>gb:AE005173_8950
JMSF046D05Sequence652000798 (6)pir|H96777|H967773e-38hypothetical protein F9E10.31 [imported] - Arabidopsis thaliana>gb:AE005173_8950229008928 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031O05+ GGGAGGATTC
                      ____________________________________________________________
consensus GGGAGGATTC
 
. : . : . : . : . : . :
JMFF031O05+ AGAAATTGATAATGATGTTGGTGATACAACCTGTGGAACCTGACTTTCTTGAGAAGCCTT
                      ____________________________________________________________
consensus AGAAATTGATAATGATGTTGGTGATACAACCTGTGGAACCTGACTTTCTTGAGAAGCCTT
 
. : . : . : . : . : . :
JMFS140D11+ GGAGACACCGATTCAGTGGTGATATCGAACAGGCTAGATCG
JMFF031O05+ TCCTTCATCCATGGAATATGGAGACACCGATTCAGTGGTGATATCGAACAGGCTAGATCG
JMFS119C04+ AGGCTAGATAG
JMSF046D05+ CG
                      ____________________________________________________________
consensus TCCTTCATCCATGGAATATGGAGACACCGATTCAGTGGTGATATCGAACAGGCTAGATCG
 
. : . : . : . : . : . :
JMFS140D11+ GCGGCGACGGCGGTTGAGGTTGCTCCGTCTAAGGAAGTATTTCTGAGCATGACTTGCCAC
JMFF031O05+ GCGGCGACGGCGGTTGAGGTTGCTCCGTCTAAGGAAGTATTTCTGAGCATGACTTGCCAC
JMFS119C04+ GCGGCGACGGCGGTTGAGGTTGCTCCGTCTAAGGAAGTATTTCTGAGCATGACTTGCCAC
JMSF046D05+ GCGGCGACGGCGGTTGAGGTTGCTCNGTCTAAGGAAGTATTTCTGAGCATGACTTGCCAC
                      ____________________________________________________________
consensus GCGGCGACGGCGGTTGAGGTTGCTCCGTCTAAGGAAGTATTTCTGAGCATGACTTGCCAC
 
. : . : . : . : . : . :
JMFS140D11+ TTGTGTAGGGGTGCGAGTCTTCACGAAATTTCTAGAGATTCCTCTCCAGTCTCCTTTTCC
JMFF031O05+ TTGTGTAGGGGTGCGAGTCTTCACGAAATTTCTAGAGATTCCTCTCCAGTCTCCTTTTCC
JMFS119C04+ TTGTGTAGGGGTGCGAGTCTTCACGAAATTTCTAGAGATTCCTCTCCAGTCTCCTTTTCC
JMSF046D05+ TTGTGTAGGGGTGCGAGTCTTCACGAAATTTCTAGAGATTCCTCTCCAGTCTCCTTTTCC
JMFF015I22+ CTAGAGATTCCTCTCCAGTCTCNTTTTCC
                      ____________________________________________________________
consensus TTGTGTAGGGGTGCGAGTCTTCACGAAATTTCTAGAGATTCCTCTCCAGTCTCCTTTTCC
 
. : . : . : . : . : . :
JMFS140D11+ GACTTTCTGCAACCCCAAAAGGAACAGCTTGTGTTCTTCCTCTGTCCATGGAACTCCTCG
JMFF031O05+ GACTTTCTGCAACCCCAAAAGGAACAGCTTGTGTTCTTCCTCTGTCCATGGAACTCCTCG
JMSF005H02+ TTCTGCAACCCCAAAAGGAACAGCTTGTGTTCTTCCTCTGTCCATGGAACTCCTCG
JMFS119C04+ GACTTTCTGCAACCCCAAAAGGAACAGCTTGTGTTCTTCCTCTGTCCATGGAACTCCTCG
JMSF046D05+ GACTTTCTGCAACCCCAAAAGGAACAGCTTGTGTTCTTCCTCTGTCCATGGAACTCCTCG
JMFF015I22+ GACTTTCTGCAACCCCAAAAGGAACAGCTTGTGTTCTTCCTCTGTCCATGGAACTCCTCG
                      ____________________________________________________________
consensus GACTTTCTGCAACCCCAAAAGGAACAGCTTGTGTTCTTCCTCTGTCCATGGAACTCCTCG
 
. : . : . : . : . : . :
JMFS140D11+ CTTTCGCTCGCGGCCACTGCTAGACTGGTTAGGAACGGCGTCATCTGCCGAAGCATAGCC
JMFF031O05+ CTTTCGCTCGCGGCCACTGCTAGACTGGTTAGGAACGGCGTCATCTGCCGAAGCATAGCC
JMSF005H02+ CTTTCGCTCGCGGCCACTGCTAGACTGGTTAGGAACGGCGTCATCTGCCGAAGCATAGCC
JMFS119C04+ CTTTCGCTCGCGGCCACTGCTAGACTGGTTAGGAACGGCGTCATCTGCCGAAGCATAGCC
JMSF046D05+ CTTTCGCTCGCGGCCACTGCTAGACTGGTTAGGAACGGCGTCATCTGCCGAAGCATAGCC
JMFF015I22+ CTTTCGCTCGCGGCCACTGCTAGACTGGTTAGGAACGGCGTCATCTGCCGAAGCATAGCC
                      ____________________________________________________________
consensus CTTTCGCTCGCGGCCACTGCTAGACTGGTTAGGAACGGCGTCATCTGCCGAAGCATAGCC
 
. : . : . : . : . : . :
JMFS140D11+ TTCGTCAGCTGCTGCTTTGGTTGAATCATTGTTTCCACTGTTCTTGTTGTCGTCATTCGG
JMFF031O05+ TTCGTCAGCTGCTGCTTTGGTTGAATCATTGTTTCCACTGTTCTTGTTGTCGTCATTCGG
JMSF005H02+ TTCGTCAGCTGCTGCTTTGGTTGAATCATTGTTTCCACTGTTCTTGTNGTCGTCATTCGG
JMFS119C04+ TTCGTCAGCTGCTGCTTTGGTTGAATCATTGTTTCCACTGTTCTTGTTGTCGTCATTCGG
JMSF046D05+ TTCGTCAGCTGCTGCTTTGGTTGAATCATTGTTTCCACTGTTCTTGTNGTCGTCATTCGG
JMFF015I22+ TTCGTCAGCTGCTGCTTTGGTTGAATCATTGTTTCCACTGTTCTTGTTGTCGTCATTCGG
                      ____________________________________________________________
consensus TTCGTCAGCTGCTGCTTTGGTTGAATCATTGTTTCCACTGTTCTTGTTGTCGTCATTCGG
 
. : . : . : . : . : . :
JMFS140D11+ CTGCTCGTACTGAGACAAGTTATTCAGACTGACGCTCTTCCTCATAGGGTCAACCTTCAC
JMFF031O05+ CTGCTCGTACTGAGACAAGTTATTCAGACTGACGCTCTTCCTCATAGGGTCAACCTTCAC
JMSF005H02+ CTGCTCGTACTGAGACAAGTTATTCAGACTGACGCTCTTCCTCATAGGGTCAACCTTCAC
JMFS119C04+ CTGCTCGTACTGAGACAAGTTATTCAGACTGACGCTCTTCCTCATAGGGTCAACCTTCAC
JMSF046D05+ CTGCTCGTACTGAGACAAGTTATTCAGACTGACGCTCTTCCTCATAGGGTCAACCTTCAC
JMFF015I22+ CTGCTCGTACTGAGACAAGTTATTCAGACTGACGCTCTTCTTCATAGGGTCAACCTTCAC
                      ____________________________________________________________
consensus CTGCTCGTACTGAGACAAGTTATTCAGACTGACGCTCTTCCTCATAGGGTCAACCTTCAC
 
. : . : . : . : . : . :
JMFS140D11+ TCTCACACCAAACAGCATGATCTCGCCGGAACCGCCGGACGCGGCCGACACCGACGAGGA
JMFF031O05+ TCTCACACCAAACAGCATGATCTCGCCGGAACCGCCGGACGCGGCCGACACCGACGAGGA
JMSF005H02+ TCTCACACCAAACAGCATGATCTCGCCGGAACCGCCGGACGCGGCCGACACCGACGAGGA
JMFS119C04+ TCTCACACCAAACAGCATGATCTCGCCGGAACCGCCGGACGCGGCCGACACCGACGAGGA
JMSF046D05+ TCTCACACCAAACAGCATGATCTCGCCGGAACCGCCGGACGCGGCCGACACCGACGAGGA
JMFF015I22+ TCTCACACCAAACAGCATGATCTCGCCGGAACCGCCGGACGCGGCCGACACCGACGAGGA
                      ____________________________________________________________
consensus TCTCACACCAAACAGCATGATCTCGCCGGAACCGCCGGACGCGGCCGACACCGACGAGGA
 
. : . : . : . : . : . :
JMFS140D11+ CTCCCCGCAACTGCGTGAATTGTGGCCGTTGCTTCCATACTGCGTGCAGCAGCGCGTGGC
JMFF031O05+ CTCCCCGCAACTGCGTGAATTGTGGCCGTTGCTTCCATACTGCGTGCAGCAGCGCGTGGC
JMSF005H02+ CTCCCCGCAACTGCGTGAATTGTGGCCGTTGCTTCCATACTGCGTGCAGCAGCGCGTGGC
JMFS119C04+ CTCCCCGCAACTGCGTGAATTGTGGCCGTTGCTTCCATACTGCGTGCAGCAGCGCGTGGC
JMSF046D05+ CTCCCCGCAACTGCGTGAATTGTGGCCGTTGCTTCCATACTGCGTGCAGCAGCGCGTGGC
JMFF015I22+ CTCCCCGCAACTGCGTGAATTGTGGCCGTTGCTTCCATACTGCGTGCAGCAGCGCGTGGC
                      ____________________________________________________________
consensus CTCCCCGCAACTGCGTGAATTGTGGCCGTTGCTTCCATACTGCGTGCAGCAGCGCGTGGC
 
. : . : . : . : . : . :
JMFS140D11+ CATCT
JMFF031O05+ CATCTTCTTCCCCTCGAGAATCGAT
JMSF005H02+ CATCTTCTTCCCCTCGAGAATCGATGAATTT
JMFS119C04+ CATCTTCTTCCCCTCGAGAATCGATGAATTT
JMSF046D05+ CATCTTNTTCCCCTCGAGAATCGATGAATTTATTGTTCAGTCANCCAAACTGTAAATATA
JMFF015I22+ CATCTTNTTCCCCTCGAGAATCGATGAATTTATTGTTCAGTCANCCAAACTGTAAATATA
                      ____________________________________________________________
consensus CATCTTCTTCCCCTCGAGAATCGATGAATTTATTGTTCAGTCANCCAAACTGTAAATATA
 
. : . : . : . : . : . :
JMSF046D05+ TATAGAGAGTTTGGGAAGAATATATATATATATATAGAGAGAGAGAGAGAGAGAGATTTA
JMFF015I22+ TATAGAGAGTTTGGGAAGAATATATATATATATATAGAGAGAGAGAGAGAGAGAGATTTA
                      ____________________________________________________________
consensus TATAGAGAGTTTGGGAAGAATATATATATATATATAGAGAGAGAGAGAGAGAGAGATTTA
 
. : . : . : . : . : . :
JMSF046D05+ TATATTCAGAGAGAGAAAGGAAGGAGTGAGGAAACGTATCGTCTGCGTT
JMFF015I22+ TATATTCAGAGAGAGAAAGGAAGGAGTGAGGAAACGTATCGTCTGCGTTGAGGCTCCAGT
                      ____________________________________________________________
consensus TATATTCAGAGAGAGAAAGGAAGGAGTGAGGAAACGTATCGTCTGCGTTGAGGCTCCAGT